Principles of Biology
2nd Edition
ISBN: 9781259875120
Author: Robert Brooker, Eric P. Widmaier Dr., Linda Graham Dr. Ph.D., Peter Stiling Dr. Ph.D.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 18.2, Problem 2TYK
Summary Introduction
Introduction:
DNA microarray is used to monitor expression of thousands of genes simultaneously. It is a collection of single stranded DNA spots with a known gene attached to a solid surface made of silica, glass or plastics. Each spot contains multiple copies of the particular gene.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Direct modification of genes may be achieved using what?
(Choose one below):
DNA microarray
CRISPR-Cas system
Hybridization
Gel Electrophoresis is used in many different forms to learn about DNA, RNA or proteins. Research one laboratory method or technique that uses DNA electrophoresis in order to learn more or make determinations about DNA, RNA or Proteins.
Name of technique or method
Brief description of what the electrophoresis results are used for in the method.
Include a link to your resources
Include an image of the results or technique you describe
TOPIC: MAKING A Recombinant DNA model
Chapter 18 Solutions
Principles of Biology
Ch. 18.1 - In the procedure shown in this figure, has the...Ch. 18.1 - Refer back to Figure 9.16. Why are primers needed...Ch. 18.1 - Prob. 2CCCh. 18.1 - Prob. 3CCCh. 18.1 - Prob. 4CCCh. 18.1 - Prob. 2BCCh. 18.1 - Prob. 1TYKCh. 18.1 - Prob. 2TYKCh. 18.1 - Prob. 3TYKCh. 18.2 - Prob. 1CC
Ch. 18.2 - Prob. 2CCCh. 18.2 - Prob. 1TYKCh. 18.2 - Prob. 2TYKCh. 18.2 - Prob. 3CCCh. 18.3 - Prob. 1TYKCh. 18.4 - Prob. 1CCCh. 18.4 - Prob. 1BCCh. 18.4 - The sizes of eukaryotic genomes vary because more...Ch. 18.4 - The members of a gene family are called paralogs....Ch. 18.5 - Prob. 1CCCh. 18.5 - Based on their mechanism of movement, which type...Ch. 18.5 - Prob. 1TYKCh. 18.5 - A segment of DNA that moves via an RNA...Ch. 18 - Prob. 1TYCh. 18 - Prob. 2TYCh. 18 - Lets suppose you followed the protocols described...Ch. 18 - Prob. 4TYCh. 18 - Lets suppose you want to clone a gene that has...Ch. 18 - In the CRISPR-Cas technology used for mutating...Ch. 18 - Prob. 7TYCh. 18 - Prob. 8TYCh. 18 - Prob. 9TYCh. 18 - Prob. 10TYCh. 18 - Draw the structure of a dideoxyribonucleotide...Ch. 18 - Prob. 2CCQCh. 18 - Prob. 3CCQCh. 18 - Identify and discuss three important advances that...Ch. 18 - Prob. 2CBQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are the ethical concerns of using stem cells? CRISPR?arrow_forwardWhich of the following scenarios could use Next-Gen sequencing to achieve its purpose? Detect viruses in samples of patients Detect species of microorganisms present in a water sample. Insert mutations to genes to alter function: Identify instances of fake food items (tuna not being tuna)arrow_forwardDiscuss the concept of the use of DNA in genome identification.arrow_forward
- What is the difference between cloning and genetic engineering? What is CRISPR and how does it work What is recombinant DNA? What is a plasmid What is a PCR and what does it do? List an ethical consideration when it comes to cloning or genetic engineering.arrow_forwardBriefly (but including important details and methods), outline HOW to clone and identify a new gene!arrow_forwardDNA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the DNA fragments are sorted, the pattern of bands can be analyzed. Gel Electrophoresis Procedure The smaller DNA fragments start to move away from the wells and the larger DNA fragments remain closer to the wells. An electric current is passed through the gel. DNA fragments are treated with a dye. A restriction endonuclease is added to the DNA. Using micropipettes, the DNA samples are added to the wells. DNA fingerprint is produced. DNA fragments are produced. The order in which a DNA fingerprint is produced using gel electrophoresis is Answer, Answer, Answer, Answer, Answer, Answer, and Answer.arrow_forward
- RECOMBINANT DNA BRIEFLY, DESCRIBE RECOMBINANT DNA AND GIVE ONE CONCRETE EXAMPLE. EVALUATE THE SIGNIFICANCE/PRACTICAL APPLICATIONS OF THIS DNA TECHNOLOGY BY CONSIDERING ETHICAL AND MORAL IMPLICATIONS BEHIND IT. RECOMBINANT DNA EXAMPLE: MODIFIED TRAIT GENE MODIFICATION RECIPIENT ORGANISM FIELDS OF APPLICATION ALSO, WHAT ARE YOUR INSIGHTS? IN 2 TO 3 SENTENCES.arrow_forwardCRISPR techniques allow scientists to modify specific genes while sparing all others, thus clarifying the association between a given gene and its consequence to the organism. If this technology can change the future of Medicine, what specific benefits CRISPR can bring to genetic testing or analysis? How can CRISPR help to enhance gene therapy or treatment of genetic diseases?arrow_forwardExamine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACarrow_forward
- Explain the rationale and achievable goals behind using a genetic screen(like Heidelberg screen). Also mention how would you choose a model organism.arrow_forwardGenetic Engineering Terms Name: Draw a line to connect each pair of boxes DNA sequencing The use of an organism, or a component of an organism or other biological system, to make a product or process. DNA cloning The sequencing, analysis, and cutting-and-pasting of DNA A technique to make many copies of a specific DNA region in vitro (in a test tube rather than anorganism) Recombinant DNA Polymerase chain reaction A technique used.to separatę DNA fragments according to their size Gel electrophoresis DNA that is assembled out of fragments from multiple sources Biotechnology A molecular biology technique that makes many identical copies of a piece of DNA, such as a gene DNA technology The process of determining the sequence of nucleotides (As, Ts, Cs, and Gs) in a piece of DNA. ww tİ6111749/enetic-engineering-temsarrow_forwardBriefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencingarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License