LO43 Identify the levels at which gene expression can be regulated in prokaryotes and eukaryotes Gene regulation in prokaryotes can occur through the following mechanisms EXCEPT: Histone methylation antisense RNA riboswitches repressors DNA methylation Regulatory elements
Q: what is the mechanism by organophospahtes inbibit enymes?
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: You are performing PCR for the first time using some new primers that are 25 nucleotides in length…
A: PCR is the process by which we increase the number of a specific nucleotide sequence. The PCR…
Q: can you explain this again in a different way
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…
Q: RESULTS Table 1. Absorbance values of BSA standards. ● ● Test Tube No. BSA (μL) DDW (μL) 100 80 60…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: At pH 7, the most predominant interaction between glucuronic acid (structure seen below) and the…
A: Electrostatic interactions are the interactions that might be attractive or repulsive that form…
Q: Problem. The student conducted a chemical experiment to prove the reducing properties of maltose…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: What is the main advantage of fluorescence polarization? Sensitivity of fluorescent probes Low cost…
A: FP is an analytical technique which provides information on orientation and mobility of…
Q: A biotech company sells a "reporter assay kit" for researchers to easily find small molecules that…
A: The glucocorticoid receptor is a type 1 hormone receptor. The receptor dissociates from the chaperon…
Q: Be able to describe how the “law of mass action” drives bicarbonate formation when the blood is in…
A: In a reversible reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration…
Q: What are the greatest structural features that differentiate sphingolipids from phosphoglycerides?
A: Introducion Fatty acids are the important component of lipids. Lipid is one of the important…
Q: how to make 100ml of TBST buffer from 1X TBS (tris buffered saline solution) and 0.1% tween-20
A: X refers to fold concentration of a sample. It means the number of times the standard or stock is…
Q: Which of these chemicals damages the brain in a way that resembles Parkinson’s disease? A. Capsaicin…
A: Dopamine is a neurotransmitter. It is synthesised by dopaminergic neurons. Parkinson's disease is…
Q: Glycogen synthase in the liver is a target for phosphorylation by two protein kinases. What are…
A: Glycogen is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: A structure of tyrosine is given and I need to draw the structure for neutral solution, pH 2 and pH…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
Q: Ketohexoses commonly exist in living systems in either the straight chain or ring (furanose) forms.…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: true/false: Pepsin cleavage of the peptide Ala-His-Gly-Trp-Val-Ile-Arg-Gly would yield the…
A: Pepsin is a proteolytic Enzyme that cleaves the peptide bonds with specificity. This can be used in…
Q: 1. Theoretically, a protein could assume a virtually infinite number of configurations and…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: What do you call the test used to detect the presence of protein in saliva?
A: Proteins are high molecular weight biomolecules. They are polymers of amino acid residues linked to…
Q: The expresion ytou have like [deprotonate][protonate]. Are they multiplying or dividing? Is not…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: 5. Which of the following is true about myoglobin and/or hemoglobin? O (a) The iron in Hb is in the…
A: Both hemoglobin & myoglobin are globular proteins. Our red blood cells (RBCs) are composed of…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Citrate synthase is regulated by another metabolite that has the opposite effect (i.e., stimulates…
A: The citric acid cycle carries out the complete oxidation of acetyl CoA molecules that are obtained…
Q: 3- True or False: A given reaction, such as the hydrolysis of ATP can do a set amount of…
A: Adenosine triphosphate, or ATP, is a small molecule. It can be viewed as the primary energy currency…
Q: (a) An experiment can be designed to test the effect of different temperature levels on the…
A: The independent variable is the parameter which we expect to affect the dependent variable. The…
Q: Kinetic Parameters of Enzyme-Catalyzed Reactions TABLE 12-1 The Values of KM, Keat, and Keat/KM for…
A: For a one-substrate enzyme catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: II. Draw the different forms of the following amino acids in solution. 1. Proline (3 forms) 2.…
A: Amino acids are basic unit of polypeptide chain. Alpha carbon of amino acids contains carboxyl…
Q: Polypeptides are continuously synthesized and broken down within living systems. One of these…
A: A protein is a chain of amino acids which can be called a polypeptide. The polypeptide chain folds…
Q: Briefly and in simple terms, describe the glycoside bond connecting two monosaccharides in a di- or…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Choose the statements that describe why the isomerization reaction is critical for the subsequent…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: What structural and functional advantages do proteins gain by associating to form quaternary…
A: In cellular environments, protein interaction networks contain crucial functional modules made up of…
Q: Just 15-3
A: Kequilibrium constant is the ratio of rate of forward reaction and rate of backward reaction and…
Q: what is does the induced -fit model account for? 2 why are most enzyme inactive at higher…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Is increasing the P; concentration a reasonable way to couple ATP hydrolysis and glucose…
A: It makes sense to relate ATP hydrolysis and glucose phosphorylation by increasing the P…
Q: Please answer the following two questions: 1. Biochemistry and function of chylomicrons 2. The…
A: Chylomicrons are lipoproteins synthesized in the intestine. Lipoproteins are compound lipids…
Q: describe the experiment that proved chemiosmotic hypothesis.
A: The chemiosmotic model of ATP synthesis states that ATP synthesis occurs by movement of protons…
Q: When muscle is at rest, creatine phosphate is produced from ATP in order to store energy. What is…
A: Most of the time, certain cellular reactions are highly endergonic reaction, that is they are…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: BIOC 385 Biochemistry of Protein Synthesis Q11.4: Considering that binding of the correct tRNA to…
A: Translation is the process of protein synthesis. It occurs in the cytoplasm. Ribosomes have peptidyl…
Q: . Mucic Acid Test for Galactose and Lactose
A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…
Q: Using a Venn include when
A: DNA replication is a vital biological process of producing identical copy of DNA using enzymes DNA…
Q: 2. Complete the following for serine, tyrosine, and gylcine. a. Draw the amino acid. b. Circle the…
A: Amino acids are the building blocks of proteins. they can be classified into different groups based…
Q: Xylulose and ribulose are epimer pairs. Please explain why and how to identify epimer pairs
A: Epimers are the simple Sugars that differ in a single chiral centre or in the arrangement of OH…
Q: Explain biochemical pathways mechanistically. Describe the β-oxidation pathway. Describe the…
A: Lipids are stored in the form of triacylglycerols in the body. When there are no carbohydrates in…
Q: Next exam will be on carbohydrates, protein equencing and enzymes iochemistry roblem Assignment…
A: Emil Fischer invented the Fischer projection, a method of representing the three-dimensional…
Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…
A: Pancreas has 3 types of cells: α cells secrete glucagon β cells secrete insulin δ cells secrete…
Q: Calculate AG for this reaction under the following conditions: 37°C, pH 7, [Pyruvate] = [CO₂] = 4.0…
A: The thermodynamic function called Gibbs free energy (G), named after Josiah Willard Gibbs, best…
Q: A certain metabolic pathway can be diagrammed as: X Y A B C D where A, B, C, and D are the metabolic…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: 2. Scheme of anaerobic oxidation of glucose and energy balance.
A: Organisms that live under anaerobic conditions rely only on glycolysis to generate ATP. Glycolysis…
Q: The catalytic efficiency of many enzymes depends on pH. Chymotrypsin, which has a well-known…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- e B 1_30*_SP23 - General Biology I (for majors)/11364 of € 2 A us page X F1 What conditions would we find on the gene of a prokaryote if there is low amounts of tryptophan within the cytoplasm? Select one: a. lactose would attach to the repressor removing it from the promoter promoting the transcription of lactase b. no repressor is on the promoter creating constant transcription of lactase c. tryptophan would attach to the repressor removing it from the promoter promoting the transcription of lactase O d. repressors would bind to the promoter stopping the transcription of lactase e. lactose would attach to the repressor removing it from the promoter promoting the transcription of tryptophan producing enzymes no repressor is on the promoter creating constant transcription of tryptophan producing enzymes tryptophan would attach to the repressor binding it to the promoter and stopping the transcription of tryptophan producing enzymes O f. O g. 2 Oh. tryptophan would attach to the…G-LO37 Identify the consequences of mutations in different regions of a gene. The image below represents two strands of DNA: the top one corresponds to a healthy individual, and the bottom one of a sibling potentially affected with a disease due to genetic mutations Mutation 1 A + с AUA ACA AUG Met ACG GUU GUC GUA GUG Val GCU GCC GCA GCG It will result in mRNA produced Mutation 2 It will result in no mRNA produced 500 AGG The protein produced will be normal 500 + GGG Ala The Select all that applies about Mutation 1 (position -6): AAGLys AGA Arg GGU GGC GGA GGG GAC Asp GAA Glu GAGJ Gly The protein produced will have a different amino acid 1235 ATT 1235 TTT 070 2070 ALL The mutation occurs in the promoter region, and this means that the mRNA cannot be produced 1535 The mRNA and protein will both be normal because the mutation occurs outside of the consensus region of the promoter G 1535 с Affected6 of 16 Which gene would most likely be under inducible expression control? O A gene that encodes for a protein required for the electron transport pathway O A gene that encodes for a protein critical for assembly of the bacterial cell wall A gene that encodes for a subunit of the RNA polymerase holoenzyme A gene that encodes for a protein that is produced in response to oxidative stress A gene that encodes for a component of a bacterial flagellar assembly
- Discuss how the expression of a protein can be regulated post transcription in eukaryotic cells through, using the following key terms: Degradation of mRNA (two ways) Blocking translation Degradation of the proteinI. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…Help me please
- Choose all that apply regarding gene transcription in eukaryotes: Multiple transcription factors are necessary to form the pre-initiation complex (PIC) of RNA Pol II. The 5' cap of mRNA requires the free triphosphate on the nucleotide at the 5' end. Introns must be removed from the initial RNA transcipt. Histone acetylation is a method controlling gene expression. Acetylation creates more positive charges on histones, leading to tighter binding of the proteins to DNA. Exons are removed from mRNA by the spliceosome. RNA polymerase II must completely finish an mRNA transcript before processing can begin. RNA polymerase I catalyzes the synthesis of the majority of ribosomal RNA. The hormone 173-estradiol binds to a G-protein coupled receptor to control gene transcription.O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) Lactose Lactose No Lactose Genotype PP0 Z Y/I P*O*Z•Y* I'POCZ Y*/I P* O©Z*Y° P O Z'Y/I P'OʻZ'Y* PP O ZY*/IP*O*Z*Y* IP OCZ Y /I P*O*Z•Y* IPO ZY*/I* P*O©Z*Y• I'PO*Z Y*/IP'O*Z*Y°Which of the following DNA regions is NOT involved in gene expression regulation in eukaryotes? Promoter-proximal elements Promoter O Enhancer O Operator
- 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…please explain how does INRNA modify the structure of the chromatin in order to regulate gene ww w w expression?From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression THERE ARE MULTIPLE ANSWER TO THE QUESTION Group of answer choices A RNA polymerase II B 3' UTR C mediator protein D 5' UTR E activators F coding sequence G specific transcription factors H general transcription factors