When muscle is at rest, creatine phosphate is produced from ATP in order to store energy. What is the AG for this reaction? creatine phosphate + H₂O ATP + H₂O - ADP + Pi Use three digits in your answer: kJ/mole creatine + Pi AG"=-43.1 kJ/mol AG = -30.5 kJ/mol
Q: Determine the direction that each of the reactions will progress. Assume that the reactants and…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: We eat foods containing sucrose (table sugar), lactose (milk sugar), and cellobiose (disaccharide of…
A: Carbohydrates that are obtained through the diet include monosaccharides, disaccharides, and…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: An enzyme has a single active site at which it can bind and hydrolyze either X or Y; however, the…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…
Q: Label the parts of the below lipid molecule. Is this a saturated or unsaturated lipid? H H I-U-I H…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: a) This molecule is produced when what amino acid is transaminated? b) What are the one- and…
A: Introduction Amino acids are the building blocks of protein. Two amino acids are joined by peptide…
Q: 1. What role do eicosanoids play in the body? What is the primary fatty acid in their composition?…
A: INTRODUCTION : Eicosanoids - They are classified as a group of molecules which are being derived…
Q: How many ADP molecules are phosphorylated as electrons of cytosolic NADH enter the mitochondria via…
A: Most textbooks mention that under aerobic conditions, NAD+ is regenerated in the ETC. But the…
Q: Hormones and other signaling molecules: definition. Classification of hormones by chemical…
A: Hormones are chemical substance that are produced by endocrine glands. While paracrine signaling…
Q: Another key component of lipids is a fatty acid. A fatty acid is recognizable by its carboxyl group.…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: 2. What is the terms used to describe what is happening to the members of the electron transport…
A: The electron transport system (ETC) is the series of redox reaction in which involved a series of…
Q: Discuss the synthesis and utilization of ketone bodies.
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 2. Name the disaccharide (shown at right) formed by glycosidic linkage of D-Glucose and D-Fructose.…
A: Carbohydrates are organic molecules that act as the major source of energy for the body.…
Q: In beta-oxidation, which cofactor is required the for second oxidation reaction (conversion of…
A: Fatty acid β-oxidation is the metabolic process by which fatty acids are broken down to produce…
Q: a. What hormone is released in response to increased blood glucose? 2. b. The binding of this…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: 2. What is the terms used to describe what is happening to the members of the electron transport…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: a) This molecule is produced when what amino acid is transaminated? b) What are the one- and…
A: Amino acids are biomolecules in which an amino group and a carboxyl group are linked to the same…
Q: What percentage of molecules of peptide GGGG has no ionized groups (e.g. has BOTH protonated…
A: Amino acids: An amino acid can function as both an acid and a base because of its structural…
Q: Please help me calculate BSA and Net Abs (explaination and details pls)
A: Bovine Serum Albumin (BSA) is the most commonly used protein in research. It is obtained from the…
Q: Show the chemical equations of the following lipid tests: (1) acrolein test, (2) saponification, (3)…
A: lipids when hydrolyzed with sodium or potassium hydroxide in aqueous or alcoholic environment,…
Q: A gerbil is fed a normal diet including 14C-lysine. After a period of time on this diet biopsies are…
A: Gerbils are mammals , so only mammalian metabolism can be used here. In the figure below showing the…
Q: The metabolic function of the pentose phosphate pathway is: act as a source of ADP biosynthesis O…
A: The breakdown of glucose, in glycolysis provides the starting molecule required for the pentose…
Q: 1. Define a polynucleotide. 2. What are the types of polynucleotides? 3. Enumerate and classify all…
A: Nucleotides are the complex compounds made up of nitrogen base, a sugar residuw and a phosphate…
Q: At pH 10, what is the net charge of the peptide Asn-His-Glu-Cys-Ser-Lys?
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Provide the reagents used and the positive result to test the following nutrients
A: Nutrients are organic and inorganic substances needed by living cells to grow and survive. Some of…
Q: what are correct about enzyme kinetic parameters
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…
Q: One of your colleagues has obtained a sample of muscle phosphorylase b that is known to be…
A: Glycogen is storage-type homopolysaccharides that contain two types of glucose polymers: amylose:…
Q: The covalent catalytic mechanism of an enzyme depends on a single active site Cys residue with a…
A: Covalent catalysis is a type of enzymatic reaction mechanism that involves the formation of covalent…
Q: Predict the nutrients present in the following food samples. Write POSITIVE if the nutrient is…
A: Nutrients are substances obtained from food that are essential for metabolism of an organism.…
Q: Which of the following is considered an omega-6 fatty acid?
A: Since animals cannot synthesize omega-6 and omega-3 fatty acids, they must be obtained from their…
Q: 20000 Indicate enzymes of glucose metabolism directly or indirectly impacted by the action of…
A: Glucose metabolism is comprised of several processes, including glycolysis, gluconeogenesis,…
Q: The Gs-alpha subunit of trimeric G proteins can function to regulate ion channels. inhibit…
A: Introduction: G-protein is a heterodimeric containing three different subunits named alpha, beta,…
Q: d. What type of inhibition is exhibited against NAD* as a cofactor? Describe what is going on in…
A: There are three types of inhibitors-competitive, non-competitive and uncompetitive. In competitive…
Q: Pathological Constituents of Urine Fill in the table below for your observations Pathological…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Choose the best answers for each missing word from the list below. (1)__________ is a first…
A: Biochemical cell signalling is the method by which cell communicates with each other cells and…
Q: In the Krebs cycle, the energy released by taking a compound off Coenzyme A is used to: Group of…
A: There are 2 two reactions in Krebs cycle were a compound is taken off Coenzyme A (CoA-SH). These two…
Q: Which symptom is the best indication of Lesch-Nyhan disease in a patient? Chronic lysis of red blood…
A: Lesch-Nyhan disease is a rare genetic syndrome caused due to hypoxanthine-guanine phosphoribosyl…
Q: Questions: 1. What test tube will show positive starch hydrolysis and negative starch hydrolysis?…
A: Starch is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: Elongation of fatty acids chains beyond 16 carbons takes place: on the membrane of the endoplasmic…
A: Acetyl CoA from glucose oxidation or other anaplerotic reactions is produced in mitochondria and…
Q: Why is de novo biosynthesis of purines markedly elevated in patients with a deficiency in…
A: HGPRT is an important enzyme in the recycling of building blocks of nucleic acids like DNA or RNA.…
Q: Enzymes as biological catalysts of metabolic reactions. Properties of enzymes as protein substances.
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: What test tube will show positive starch hydrolysis and negative starch hydrolysis?
A: Starch is the most common carbohydrates (polysaccharides) which is a polymer of several glucose…
Q: After doing the preliminary studies on redcrest protein extract, Tighnari proceeded with its…
A: Proteins are macromolecule comprised of amino acids linked by peptide bonds which forms a primary…
Q: What could be seen in the organic acid precipitation during the protein denaturation experiment if…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: Report Table PP.7: Ninhydrin test Analysis of results for the Ninhydrin tests Glycine Tyrosine…
A: Proteins are folded peptides. Peptides are made up of amino acid residues linked via a peptide bond.…
Q: Draw the two possible Haworth structures (both alpha and beta anomers) for the following…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: 4. Shown below is the structure of the anti-retroviral drug AZT. 5' HOCH, H 3 N₂ HN AZT H 12 H CH₂…
A: AZT is a drug that is used to treat HIV. HIV is a retro virus that causes the syndrome AIDS. When…
Q: In making the experiment of protein denaturation, what usually happens upon, precipitation of strong…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: EXPLAIN your choices for each of the following: a) The Hb variant least likely to cause…
A: In general, the quaternary structure of any protein is determined by the amino acids present in that…
Q: The following carbohydrate is classified as a(n): CH2OHCHOHCHOHCHOHCHOHCHO O ketohexose O…
A: Monosaccharides are the simplest carbohydrates. They are classified into two based on the functional…
Q15
Step by step
Solved in 2 steps
- In human resting muscle cells, the concentration of ATP is 4 mM, ADP is 0.013 mM, creatine-phosphate is 25 mM and creatine is 13 mM. Calculate the ΔG for the formation of creatine phosphate from ATP and creatine in kJ/mol and do not include unit in your answer.0.75/ Question 20 What is the difference between treppe and tetany? Mark ALL that apply. there is no summation in tetany there is no summation in treppe the contractions successively increase giving a "staircase" image treppe goes away after muscle is fully warmed up treppe is caused by gradual warming of an unstimulated muscle thus increasing diffusion of ions and protein movement needed to cause contractions.Muscle contraction involves a protein conformational change called the power stroke. Where ultimately does the energy come from that allows a series of conformational changes involved in the power stroke? O Ca2+ O ATP hydrolysis O Actin polymerization O GTP hydrolysis
- In active muscle cells, the pO2 is about 10 torr at the cell surface and 1 torr at the mitochondria(the organelles where oxidative metabolism occurs). Calculate the percentage of bound oxygentransported to the mitochondria of muscle cells by myoglobin (KD = 2 torr).Assume that the complete combustion of one mole of glucose to carbon dioxide and water liberates 2870 kJ/mol (AGo' = -2870 kJ/mol). If one contraction cycle in muscle requires 67 kJ, and the energy from the combustion of glucose is converted with an efficiency of 35% to contraction, how many contraction cycles could theoretically be fueled by the complete combustion of one mole of glucose? Round your answer to the nearest whole number. суycles per mole glucoseIntracellular concentrations in resting muscle are as follows: fructose6-phosphate, 1.0 mM; fructose-1,6-bisphosphate, 10 mM; AMP, 0.1 mM;ADP, 0.5 mM; ATP, 5 mM; and Pi, 10 mM. Is the phosphofructokinasereaction in muscle more or less exergonic than under standard conditions?By how much?
- Why do muscle cells use creatine phosphate insteadof glycolysis to supply ATP for the first few seconds ofmuscle contraction?During muscle contraction, some energy is supplied from creatine phosphate. Which of the following events occurs during the breakdown of creatine phosphate? Question 6 options: a ATP molecules breakdown producing ADP + P groups. b ATP molecules are formed when P groups are bonded to ADP. c ADP molecules break down producing AMP + P groups. d ADP molecules are formed when P groups are bonded to AMPRefer to the figure below. VI ATP II ADP II ADP ADP (P) Reference: Ref 20-2 In the figure, which panel, taken out of context, represents a state where muscle relaxation could be occurring? Select one: O a. II O b. IV О с. VI
- After death, a person no longer makes ATP, so calcium stored in the sarcoplasmic reticulum diffuses down its concentration gradient into the muscle cytoplasm. This result is rigor mortis----an unbreakable state of muscle contraction that stiffens the body for a few days until muscles begin to decay. Explain why this contraction occurs.If you were able to control fatigue in the muscle cell experimentally such that you only exposed the muscle to high levels of Pi and no other metabolites, what would you observe? A decline in force without much change in velocity A decline in velocity without much change in force A muscle operating below Lo A decline in both force and velocity An increased affinity of Ca2+ for troponin44 45 Muscular atrophy occurs when: A BO CO Muscle fibers shrink and get significantly weaker because they aren't being used. A patient lacks the coordination needed to walk normally. Muscles increase in size due to exercise. DO Fat replaces muscle tissue in children. What does it mean when the PT says a patient's legs scissor when he ambula
