Human growth hormone (hGH) activates expression of the PIND gene in NIH3T3 cells by inducing binding of a transcription factor to the promoter region between -385 and -178 base pairs upstream of the transcription start point. To find the exact binding site of the transcription factor an in vivo footprinting experiment is done with DMS, a chemical compound that will enter the cells and cut the DNA at G residues if no transcription factor is bound to the residue. N C hGH Figure 3.1 In vivo footprint of the PIND gene promoter. The DNA sequence is shown next to the footprint. Lane N is a footprint of “naked" DNA. (Purified DNA with no bound proteins). Lane C is a footprint of NIH3T3 cells that do not express PIND. Lane hGH is a footprint of NIH3T3 cells treated with human growth hormone that induces expression of PIND. 1. Why are some bands missing in lane hGH but not in the two other lanes? || || | || SATACGGAAGGTTGCTGCTGTTGTATGGCT

Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN:9781305251052
Author:Michael Cummings
Publisher:Michael Cummings
Chapter10: From Proteins To Phenotypes
Section: Chapter Questions
Problem 21QP: Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to...
icon
Related questions
Question

please help. do 1st problem

Human growth hormone (hGH) activates expression of the PIND gene in NIH3T3 cells by inducing
binding of a transcription factor to the promoter region between -385 and -178 base pairs upstream
of the transcription start point. To find the exact binding site of the transcription factor an in vivo
footprinting experiment is done with DMS, a chemical compound that will enter the cells and cut
the DNA at G residues if no transcription factor is bound to the residue.
N C hGH
Figure 3.1 In vivo footprint of the PIND gene promoter.
The DNA sequence is shown next to the footprint.
Lane N is a footprint of “naked" DNA. (Purified DNA with no bound
proteins).
Lane C is a footprint of NIH3T3 cells that do not express PIND.
Lane hGH is a footprint of NIH3T3 cells treated with human growth
hormone that induces expression of PIND.
1. Why are some bands missing in lane hGH but not in the two other
lanes?
2. In how many places does the transcription factor bind to the
promoter?
3. What is the sequence of the most likely binding site for the
transcription factor in the PIND promoter?
|||
||
||
TGGTGTGTGGAAGGAGATAGAGTGAGATACGGAAGGTTGCTGCTGTTGTATGGCT
Transcribed Image Text:Human growth hormone (hGH) activates expression of the PIND gene in NIH3T3 cells by inducing binding of a transcription factor to the promoter region between -385 and -178 base pairs upstream of the transcription start point. To find the exact binding site of the transcription factor an in vivo footprinting experiment is done with DMS, a chemical compound that will enter the cells and cut the DNA at G residues if no transcription factor is bound to the residue. N C hGH Figure 3.1 In vivo footprint of the PIND gene promoter. The DNA sequence is shown next to the footprint. Lane N is a footprint of “naked" DNA. (Purified DNA with no bound proteins). Lane C is a footprint of NIH3T3 cells that do not express PIND. Lane hGH is a footprint of NIH3T3 cells treated with human growth hormone that induces expression of PIND. 1. Why are some bands missing in lane hGH but not in the two other lanes? 2. In how many places does the transcription factor bind to the promoter? 3. What is the sequence of the most likely binding site for the transcription factor in the PIND promoter? ||| || || TGGTGTGTGGAAGGAGATAGAGTGAGATACGGAAGGTTGCTGCTGTTGTATGGCT
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 3 steps with 2 images

Blurred answer
Knowledge Booster
Immune disorders
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co…
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning