What event in eukaryotes serves as the "trigger" for entering the elongation phase of transcription by RNA polymerase lH? O the formation of the first phosphodiester bond of the transcript, assisted by TFIIH and TFIIE (5) acetylation of the tails of histones H3 and H4 the activation of the phosphatase by TFIIF O phosphorylation of the CTD of RNA pol II by the kinase of TEIIH the leaving of sigma from the promoter

What event in eukaryotes serves as the "trigger" for entering the elongation phase of transcription by RNA polymerase lH? O the formation of the first phosphodiester bond of the transcript, assisted by TFIIH and TFIIE (5) acetylation of the tails of histones H3 and H4 the activation of the phosphatase by TFIIF O phosphorylation of the CTD of RNA pol II by the kinase of TEIIH the leaving of sigma from the promoter

Name: What event in eukaryotes serves as the "trigger" for entering the elo
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What event in eukaryotes serves as the "trigger" for entering the elongation phaseof transcription by RNA polymerase lH?O the formation of the first phosphodiester bond of the transcript, assisted by TFIIH andTFIIE (5) acetylation of the tails of hi

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

Compared to heterochromatin, euchromatin is comprised of densely packed nucleosomes and with higher transcription activity comprised of densely packed nucleosomes and with lower transcription activity O comprised of loosely packed nucleosomes and with lower transcription activity Ocomprised of loosely packed nucleosomes and with higher transcription activity
TAN TTGC IGGAG Nanog regulatory sequence Given this interaction map which DNA sequence would the transcription factor most likely bind to? CAAGGAG ATTAACG TAATTGG TAATTGC
Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank you
The post transcriptional modifications of the mature prokaryotic messenger RNA are essential in ribosome binding and stabilizing the mRA. Is this true or false?
The transcriptional complement of the DNA strand with the code 3’ TAA-CAT-GCT 5’ is
What is the mrna codon that corresponds with binds to the anticodon of this trna molecule ccg ggc accounting ugg cgg?A bacterial is the nontranscribed region of the dna to which rna polymerase binds in order to initiate transcription?What happens during the elongation stage of dna transcription what is the function of rna polymerase?
A single mutation in one of the transcription factors inProblem 33 results in a drastic reduction in YFG transcription. Diagram what this mutant interaction mightlook like
What effect would inhibitors of histone deacetylases have upon transcription? Group of answer choices They would increase transcription by making the chromatin more compact They would increase transcription by making the chromatin less compact They would decrease transcription by making the chromatin more compact They would decrease transcription by making the chromatin less compact For this question, we will consider a eukaryotic mRNA that has four exons (E1, E2, E3, E4) and three introns (I1, I2, I3). What could occur if a protein were to bind over the 3' splice site of intron 2 (I2)? Group of answer choices The processed mRNA would consist of: E1+E2+E3+E4 The processed mRNA would consist only of: E1+E3 The processed mRNA would consist only of: E3+E4 The processed mRNA would consist of: E1+E2+E4
19Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their 3'-ends. Yesorno 20Messenger RNA splicing and export are uncoupled processes. Yesorno twenty oneWhich of the following plays an important role in directing newly synthesized proteins to specific cellular destinations?A.signal sequenceb.nuclear localization signalc.chain elongation stretchD.Shine – Dalgarno
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
Some transcription regulators bind to DNA andcause the double helix to bend at a sharp angle. Such“bending proteins” can affect the initiation of transcrip-tion without directly contacting any other protein. Can youdevise a plausible explanation for how such proteins mightwork to modulate transcription? Draw a diagram that illus-trates your explanation.
The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.