A mutation in a bacterial protein-coding gene with a standard consensus promoter deletes the two base pairs at the transcription start site and at the position immediately preceding it (the -1 and +1 positions). What will be the most likely effects, if any, on the transcript and the encoded polypeptide? Both the transcript and the polypeptide will be unchanged. O The transcript will be 2 bases shorter; the polypeptide will be completely different due to a frameshift. The transcript will be 2 bases shorter; the polypeptide will be one amino acid shorter but otherwise unchanged. Transcription will not be initiated, so ncither a transcript nor a polypeptide will be produced. O The transcript will be 2 bases shorter: the polypcptide will be unchanged.

A mutation in a bacterial protein-coding gene with a standard consensus promoter deletes the two base pairs at the transcription start site and at the position immediately preceding it (the -1 and +1 positions). What will be the most likely effects, if any, on the transcript and the encoded polypeptide? Both the transcript and the polypeptide will be unchanged. O The transcript will be 2 bases shorter; the polypeptide will be completely different due to a frameshift. The transcript will be 2 bases shorter; the polypeptide will be one amino acid shorter but otherwise unchanged. Transcription will not be initiated, so ncither a transcript nor a polypeptide will be produced. O The transcript will be 2 bases shorter: the polypcptide will be unchanged.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
The following logo plot represents the preferred cis-regulatory sequences (i.e. transcription factor binding site) of bHLH transcription factor FOSL1. C 1 2 3 4 5 6 7 8 9 10 11 position Would you expect this sequence to be recognized by a monomer, a homodimer, or a heterodimer of the protein? Explain your answer. (short phrases are sufficient; please write your answer into the template below) A- В I A -l expect FOSL1 to bind as a: (monomer, homodimer, heterodimer; please choose) B - short explanation: information content (bit) !!
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?
Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the one-letter abbreviation of the protein product of the mRNA transcript?
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?
c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…
"Upstream" "Downstream" Exons Start of transcription Termination codon 5 3' Promoter initiator codon Introns Polyadenylation signal (intervening sequences) 5' untranslated region 3' untranslated region Direction of transcription Please study the diagram above on eukaryotic gene expression. In order to provide instructions for gene expression, a eukaryotic gene should have the following sequences except for O A. Promoter B. Start codon also known as initiator codon C. Splicing signals (dinucleotide sequence in the intron) O D. 5' CAP sequence
The following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT O The mutation would bind the promoter to the consensus and produce normal levels of transcription O The mutation would inhibit the promoter thereby inhibiting transcription The mutation would move the promoter away from consensus and reduce the level of transcription O No change the consensus TATAAT sequence in the same. D00 F3 F4 F5 F6 F7 F8 F9 % & 5 6 7 8 9 %24
Draw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location. Draw the SMN2 mature mRNA before treatment with Spinraza. What type of alternative splicing is occurring? Draw the SMN2 mature mRNA after treatment with Spinraza
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
For a specific type of mutation at a given location in a particular gene, identify whether it will affect the size of the mRNA, the protein, or both. How would the mutant appear on a gel in comparison to the original