Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?
Q: The inability of DNA polymerase to replicate the ends of linear chromosome in one strand, compare…
A: Introduction The biological process of producing two identical copies of DNA from a single original…
Q: In bacteria, the ___consensus sequence of mRNA binds to the ____rRNA of the 30S small subunit during…
A: * Translation is the process in which genetic code is present in a messenger RNA molecule is decoded…
Q: Structural Stability of DNA True or false Hydrophobic bonding between stacked purine and…
A: Hi! Thank you for posting the question on Bartleby. As per the guidelines we can answer only one…
Q: 11) (recall) Transcription: what would be the APPROPRIATE NUCLEOTIDES (???? ?) in newly synthesized…
A: The DNA that makes the genetic material for all prokaryotes and eukaryotes is nothing but a code for…
Q: How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one…
A: Restriction endonuclease is defined as an enzyme responsible for cleaving DNA into small fragments…
Q: Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to- 3'5'-to-3' direction. Other…
A: The helicase is the protein complexes that are known to separate the DNA strands using the ATP as an…
Q: Tick the correct statements: Remember: Tautomers are structural isomers that differ from each…
A: Ans). The first statement, the third statement, and the fourth statement are correct. Explanation:…
Q: Modified True or False: Write TRUE if the statement is correct, if the statement is false, change…
A: There are three options to be read as True and False and are answered and corrected in Step 2
Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…
A: There are different types of mutations, that result in a change or no change in the protein…
Q: Analyzing: Each nucleotide in a DNA molecule consists of a: * sulfur group, deoxyribose, and a…
A: 1.
Q: Structure of lactam.. 1) Why this lactam would be evolutionarily selected against? a. Amino acids…
A: β-lactam antibiotics are antibiotics that contain a beta-lactam ring in their chemical structure.…
Q: Mutated DNA Sequence #3 T A C A C C T TAG C GACGACT... What's the mRNA sequence? (Circle the change)…
A: DNA sequencing is the process of determining the nucleic acid sequence in the order of the…
Q: 16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription…
A: Proteins are polymers of amino acids formed via peptide bond between two amino acids .
Q: 14) (recall) A particular triplet of bases in the template strand of DNA is AGT. The corresponding…
A: During the method of transcription, the data encoded inside the deoxyribonucleic acid sequence of 1…
Q: Please explain the full DNA synthesis process
A: DNA synthesis occurs when a cell divides, in the process known as replication. DNA replication is…
Q: Suggest a reasonable strategy for the specific phosphorylation of the 5’ –OH group of a nucleoside.
A: Nucleosides are glycosylamines. They are basically nucleotides devoid of a phosphate group. It…
Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…
A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…
Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…
A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…
Q: e transfer-RNA and the amino acid structure attached to 5' 10
A: In molecular biology and genetics,translation is a process which comes after transcription and in…
Q: Contrast DNA replication with gene expression (transcription→translation)—when does each occur?
A: DNA replication is the bio-process by which the double-helix DNA system is duplicated, whereas gene…
Q: 11) (recall) Transcription: what would be the APPROPRIATE NUCLEOTIDES (?????) in newly synthesized…
A: transcription is the process by which the dna molecules are converted into messenger rna molecule .
Q: Fill in the blanks: Modified True or False: Write BIOCHEM if the statement is true. If the statement…
A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…
Q: DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl…
A: DNA polymerase is an enzyme involved in the synthesis of DNA molecules by joining the dNTPs…
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…
A: Mutation: - Random process - Non-directional - Most of the mutations are harmful - Most of the…
Q: Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand…
A: Translation is a process of reading of mRNA to form proteins. It requires several components ljke…
Q: "The polarity of the mRNA molecule, which is synthesized during translation, runs from 5' - 3'…
A: Cell is the basic unit of all living tissue. In humans, there is a structure called the nucleus .…
Q: Central Dogma Application: Using the basic concept of Process of central dogma provide the following…
A: According to the central dogma, the most common pattern of information in our cells is: From…
Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…
A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…
Q: . DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl…
A: The process of DNA synthesis occurs in all of the living organisms and serves as a base for…
Q: True/false? if false, justify briefly The bacterial nucleoid comprises linear nucleic acid…
A: The genetic material of the cells is contained in the DNA which has the blueprint for the synthesis…
Q: F. RNA TRANSCRIPTION AND GENE EXPRESSION 1. The template strand of a segment of double-helical DNA…
A: Francis Crick proposed the central dogma which states that the DNA is replicated to produce DNA…
Q: tRNA True or false A given tRNA can be charged with only one particular amino acid The anticodon…
A: Transfer RNAs- Transfer ribonucleic acid is an RNA molecule that aids in the translation of a…
Q: Mutations and DNA repair. Francis Crick's "wobble pairing" hypothesis suggested an economical…
A: The process by which the information coded in RNA (mRNA) is decoded into a polypeptide is one of the…
Q: protein synthesis 2 When the DNA sequence TGACT is copied to RNA, the sequence in RNA will be Select…
A: The Central Dogma of Molecular Biology shows that DNA is converted into RNA, which further makes…
Q: sequence is 3 A DNA sequence before and after rep from left to right. The table below shows which…
A: DNA ( Deoxyribonucleic acid ) is a genetic material in most of organism . It is two stranded ,…
Q: Modified True or False: Write TRUE if the statement is correct, if the statement is false, change…
A: Note: Since we only answer up to three sub-parts, we’ll answer the first 3. Please resubmit the…
Q: C9. The peptide “backbone" consists of repetitive "“units" of amino group nitrogen-alpha…
A: Proteins are biopolymers made of amino acid units. Amino acids are comprised of carbon, hydrogen, a…
Q: Transcription and Translation For the following strand of DNA, show me the messenger RNA strand and…
A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…
Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…
A: Introduction A mutation is a modification to the DNA sequence of an organism. Mutations can result…
Q: Substituting antisense oligonucleotide non-bridging oxygen atoms with a sulpha atom: Select
A: Ans. 1. Option d is correct The antisense nucleotide non bridging oxygen atom replace by the sulphur…
Q: Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences,…
A: All humans have deoxyribonucleic acid (DNA) as constituent genetic material. This biochemical…
Q: MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by errors…
Q: INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a.…
A: In cells, DNA is present as genetic material that codes for mRNA, and mRNA in turn codes for the…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: The sense strand is the DNA strand that has the same sequence as mRNA, which uses the antisense…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…
Q: Complementation and mapping analyse of Lac− mutants
A: Introduction: The lactose operon is a type of operon that is needed to transport and metabolize…
Q: REPLICATION, TRANSCRIPTION, & TRANSLATION REVIEW DNA REPLICATION Fill in the complementary DNA…
A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It consists of purines and…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.Translation. Write the anti-codon sequence of the MRNA transcript. Translate the MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter abbreviation. ANTI-CODON 3' 5' SEQUENCE AMINO ACID N- C- SEQUENCE (3 letter terminus Abbreviation) Terminus AMINO ACID N- C- SEQUENCE (1 letter terminus Abbreviation) TerminusRNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
- Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNAHi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is altered in the chromosome b. More than one answer choice is correct c. The mRNA is altered by Guide RNAs d. Translation first takes place, following by altering of the coding sequenceOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
- Be sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А А10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anI am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…
- Open reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translationRNA sequence. ate 3' and 5' ends on BOTH strands ate which strand served as the TEMPLATE strand and which ING strandTrue or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.