AGAUUAUCAUAAUGGUUGUCGUAGUGllellelleMetValValValValACUACCACAACGGCUGCCGCAGCGThrThrThriThriAlaAlaAlaAlaAAUAACAAAAAGGAUGACGAAGAGAsnAsnLysLysAspAspGluGluAGUAGCAGAAGGGGUGGCGGAGGGSerSerArgArgGlyGlyGlyGlyDUA GU CAUсА Be sure to answer all parts.Write a possible mRNA sequence that codes for each peptide.a. His-Cys-Tyr-Val-Ser5¹-b. Phe-Val-Thr-Tyr-Glu5'-5'-c. Trp-Phe-Asn-Gln-3'U-3'сTable 26.2 The Genetic Code-Triplets in Messenger RNAFirst Base(5' end)-3'UUUUUUCUUAUUGCUUCUCCUACUGAULPhePheLeuLeuLeuLeuLeuLeulaCUCUUCCUCAUCGCCUCCCCCACCGSecond BaseAUAUUACUAAUAGCAUCACCAACAGSerSerSerSerProProProProTyr55TyrStopStopHisHisGinGinGUGUUGCUGAUGGCGUCGCCGACGGCysCysStopTrpArgArgArgArgThird Base(3¹ ond)DUAC DU AGсАА

Name: AGAUUAUCAUAAUGGUUGUCGUAGUGllellelleMetValValValValACUACCACAACGGCUGCCG
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: AGAUUAUCAUAAUGGUUGUCGUAGUGllellelleMetValValValValACUACCACAACGGCUGCCGCAGCGThrThrThriThriAlaAlaAlaAlaAAUAACAAAAAGGAUGACGAAGAGAsnAsnLysLysAspAspGluGluAGUAGCAGAAGGGGUGGCGGAGGGSerSerArgArgGlyGlyGlyGlyDUA GU CAUсА Be sure to answer all parts.Write a poss

Normally there is a unidirectional flow of information from DNA to RNA and RNA to proteins. This is…

Answered: Be sure to answer all parts. Write a…

Science

Biology

Be sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- -3' -3' c. Trp-Phe-Asn-Gln

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 7P

See similar textbooks

Similar questions

All about splicing A. snRNPs interactions will bring the 5' and 3' splice sites together in the pre-mRNA B. lariat formation is necessary to bring the branch site with the 5' splice site of the intron C. an unstable 5'P and 2'OH phosphodiester bond helps form the lariat D. exon 5' splice site consensus sequence GU and its 3' splice site AG are recognized by snRNPs E. various types of snRNPs and the pre-RNA come together to form the spliceosome A, B, C, E only A, B, C, D, E A, B, C only B, C, D, E only
Need help:. Researchers add poly-(CGU) to an in vitro TL system. What poly-amino acids are produced? How would the researchers determine which codon encoded each of these amino acids? 5’CGUCGUCGUCGUCGUCGUCGUCGU...3’
Please help with all parts of A, B, C, D 2. You are studying the function of a messenger RNA named Genetixrox and want to label themRNA with a radioactive atom. Assume the mRNA is long and contains all four standardRNA bases. Assume that the cell cannot convert ribonucleotides to deoxyribonucleotides (orvice versa).A. Will you generate radioactive Genetixrox mRNA with 3H-threonine? Threonine is an aminoacid. Answer yes or no, and provide a one sentence rationale.B. Will you generate radioactive Genetixrox mRNA with 3H-adenosine triphosphate? Answeryes or no, and provide a one sentence rationale.C. Will you generate radioactive Genetixrox mRNA with 3H-deoxyadenosine triphosphate?Answer yes or no, and provide a one sentence rationale.D. Will you generate radioactive Genetixrox mRNA 12C-with adenosine triphosphate? Answeryes or no, and provide a one sentence rationale
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. A glycosidic bond connect the phosphate group to ribose. Before the mRNA can be used in translation, it has to undergo splicing, 3’ cap and 5' poly-A tail post-transcription modifications.
tRNA enzyme. Any given aminoacyl-tRNA synthetase: a. Attaches the amino acid to the 5′-end '5end of the tRNA b. Always recognizes only one specific tRNA c. Recognizes all tRNA molecules d. Forms an ester linkage between the amino acid and the tRNA
Translation. Write the anti-codon sequence of the MRNA transcript. Translate the MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter abbreviation. ANTI-CODON 3' 5' SEQUENCE AMINO ACID N- C- SEQUENCE (3 letter terminus Abbreviation) Terminus AMINO ACID N- C- SEQUENCE (1 letter terminus Abbreviation) Terminus
An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.
Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a really small gene and matching complete amino acid sequence of its gene product. GGT ATG GGG ACT TTG AGG ATG ATA AGG CGT AAA TAA ATAT Met Gly Thr Leu Arg Met Ile Arg Arg Lys A mutant is found that has the following protein sequence: Met Gly Thr Leu Arg Gly. What is the likely mutation? between T14 and G15, insert T. G7 -> del. T5 -> del. G29, T30, A31 -> del between T14 and G15, insert AA. A31 -> T. C11 -> del
Figure out the mutation. You will need the codon table to answer this question. Wild type DNA sequence at 5' end of the coding region and the corresponding wild type protein sequence of its amino end: ACA TAA ATG TCT CAG TAT GGG TAT GAG AAC GAC ATT CAC ATA ATT ... Met Ser Gln Tyr Gly Tyr Glu Asn Asp Ile His Ile Ile ... This protein sequence matches the DNA sequence exactly in the wild type. A mutant is found that has the following protein sequence: Met Ser Gln Tyr Gly Thr Phe Thr. What is the likely mutation? between T4 and A5, insert G between C13 and A14, insert C G9 -> del between G20 and G31 -> del T24 -> A T22 -> G
Chrome ... x ← C Port A m ERNA F i t DESE a e d Use the codon table to determine which mRNA triplets code for the amino acid cysteine, Cys. Second mRNA base C A (5' 0 f COTON COCO с b CUA OG Course H U 000 UUU UUC UUA UUG CUU CUC CUG AUU AUA AUG Submit GUU mylabmastering.pearson.com/?courseid=12411621&key=28... ☆ GUC AUC lle UGG UGC UGU ACA AGU U 833 Phe Leu GUA n) GUG Select all that apply. Leu View Met or start Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG 160 History Bookmarks Profiles Tab Window Help QuickLaun X Thr Request Answer Ser Pro Ala UAU UAC UAA Stop UAG Stop CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr His Gin Asn Lys Asp Glu CGA UGU UGC UGA Stop A UGG Trp G CGU U CGC CGG AGU AGC AGA AGG GGU GGC GGA QuickLaury X G GGG Cys Arg Ser Arg Gly NOV 6 UT h CA A b a G U C G So OcO O COTON Right to be (3¹ X Gn) M (no subje x ☆出口口 **** 31 + U JO
MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.