Analyzing: Each nucleotide in a DNA molecule consists of a: * sulfur group, deoxyribose, and a nitrogen base phosphate group, deoxyribose, and an oxygen base phosphate group, ribose, and a nitrogen base phosphate group, deoxyribose, and a nitrogen base Remembering: Which of the following activities occur during DNA base pairing? * O adenine bonds with thymine thymine bonds with cytosine O thymine bonds with guanine

Analyzing: Each nucleotide in a DNA molecule consists of a: * sulfur group, deoxyribose, and a nitrogen base phosphate group, deoxyribose, and an oxygen base phosphate group, ribose, and a nitrogen base phosphate group, deoxyribose, and a nitrogen base Remembering: Which of the following activities occur during DNA base pairing? * O adenine bonds with thymine thymine bonds with cytosine O thymine bonds with guanine

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

A. Draw a detailed structure of DNA strand using the following sequence of bases 5'A -C- G 3' Show the structure of the phosphate group, pentose sugar and nitrogen containing base B. Why is DNA called the blueprint of an organism?
a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?
Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA molecule without breaking the hydrogen bonds that hold the bases together. indicate how, through such contacts, a protein can distinguish a T-A from a C-G pair. indicate the parts of the nucleotide base pairs that could form noncovalent interactions— hydrogen bonds, electrostatic attractions, or hydrophobic interactions -with a DNA-binding protein.
Compare and contrast the structure of DNA and RNA. Be sure to describe each of the three components of a nucleotide for both DNA and RNA along with the types of bonds formed between the components. In addition, explain: how the nucleotides link together to form each molecule, why the prime ends are labeled 5’ and 3’, what antiparallel is, what phospodiester linkages are and what complementary base pairing is.
What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT
Consider normal B-form DNA. It forms a regular antiparallel double-helical structure with Watson-Crick base-pairing mediated through hydrogen bonding. The base pairs all stack upon one another, with 3.4 Å spacing between them. DNA strands having a complementary sequence will spontaneously form a double-helix in an aqueous solution. In terms of energy, what primarily drives helix formation? O Positive Entropy from base stacking van der Waals interactions O Hoogsteen interactions Positive Enthalpy from Hydrogen Bonding between GC and AT pairs Negative Enthalpy from Hydrogen Bonding between GC and AT pairs O Negative Entropy from base stacking
State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
. Which of the following equations is a prediction based on Chargaff’s rules for the content of DNA? adenine + thymine = guanine + cytosine thymine + adenine = cytosine + guanine guanine + cytosine = adenine + thymine cytosine + guanine = thymine + adenine adenine + cytosine = thymine + guanine
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
What is the role of GelRed® in Agarose gel electrophoresis of DNA fragments? Please select the single answer that is most correct GelRed® moves down the agarose gel in response to the electric current and enables visualisation of the position of A the nucleic acids within in the agarose gel. GelRed® intercalates with the Nucleic acid and, under UV light, fluoresces to enable visualisation of the position of the nucleic acids in the agarose gel. GelRed® intercalates with the Nucleic acid and enables visualisation of the position of the nucleic acids in C the agarose gel. GelRed® intercalates with the amino acids in the agarose gel and enables visualisation of the position of their in D the agarose gel.
Can you: describe the 2 D and 3 D structure of DNA including the bonding that takes place?
Match the following terms with their correct definition. The structure of double-standed DNA Hold the base pairs together and make up the rungs of the DNA double helix One strand of nucleotides running in the opposite direction of the other strand Consists of a phosphate, a sugar backbone, and a nitrogen base A-T and C-G base pairs Five-carbon sugar found in DNA Complementary base pairs Double helix Antiparallel Nucleotide Hydrogen bonds Deoxyribose sugar