Central Dogma Application: Using the basic concept of Process of central dogma provide the following answer in the given DNA sequence on how genetic information flow. IV. Given DNA Sequence: ATCGATCGCGATCGATTACATATGCGCCCCTTTTTCCCGGGAATAATGCTAGCTAGCATGCATCAG Product of Replication: ( Product of Transcription: Product of Translation:
Q: In Figure 20-18, what is the evidence that polyploid formation has been important in plant…
A: Polyploidy Heritable disorder The presence of more than two full sets of chromosomes distinguishes…
Q: What molecules or structures are present in cell that might interfere with DNA extraction?
A: DNA extraction is a method used to purify DNA from a sample. Here seperation of DNA occur from…
Q: Which enzyme is responsible for proofreading nucleotides during DNA replication? a nuclease b…
A: Transmission of DNA or genetic material is very crucial to propagate gene from parent to offspring.…
Q: Question 47 Food is prevented from entering the trachea by the O larynx. O pharynx. O sphincter…
A: The tube like structure that connects posterior nasal and oral cavities to Larynx and esophagus is…
Q: The ascomycete life cycle typically includes (a) mainly diploid thalli (b) the formation of a thick…
A: Introduction :- Ascomycota are septate fungi with filaments divided by septa, which are cellular…
Q: Illustrate a model of female reproductive system of frog showing structures and pathways during…
A: Oviposition is a widespread process in vertebrates apart from eutherian mammals, and it refers to…
Q: _____ is a change in the order of one nucleotide in a section of a DNA molecule. a Point mutation b…
A: Option A is correct because a point mutation is a type of mutation in DNA or RNA, the cell's…
Q: In what ways (both positive and negative) are fungi important in modern biology and medicine?
A: Study of fungi is defined as Mycology.Fungi are heterotrophs that absorb nutrients.Fungi are…
Q: What do you think are some best practices to control viral diseases in Aquaculture systems? Explain…
A: Aquaculture is the fastest growing food-producing sector globally and, with intensification of the…
Q: How is RT PCR used to detect Ebola? How does the actual RT PCR procedure work? How is ELISA used to…
A: SOLUTIONThe RT-PCR and antigen-capture diagnostic assays proved very effective for detecting…
Q: Hello! dicuss the adaptations of Grapevine downy mildew to invade and manipulate their hosts.…
A: INTRODUCTION Downy mildew is a dangerous fungal disease that can cause significant crop loss in…
Q: different
A: Xenobiotics are the chemical substances present in the animal body which not found naturally in…
Q: Explain how the features listed in Table 1 serve as adaptations that might improve the survivability…
A: The animal body is a very complex creature made up of several systems. Each system in the body has a…
Q: pathways during
A: oviposition :-It involves the deposition of the mature egg outside the body of the female and…
Q: correct
A: Telomeres are present at the end of the chromosome strand and these are the repeated DNA sequences…
Q: Why do flexion and torsion events occur in the developing embryo?
A: LONGITUDINAL FOLDING (Torsion) produces both head- and tailfolds, or flexion, and creates a cranial…
Q: Question 7 (2 points) Determine the matching base pairs that RNA polymerase would lay down for this…
A: RNA polymerase involved in mRNA synthesis or transcription process. Through transcription…
Q: QUESTION 4 Target cel receptors can be activated or inhibited by specific hormones O True O False…
A: Hormones attach to receptors on target cells, causing biological changes. In reaction to hormone…
Q: During a mass spectrometry experiment, the spectrum of vascular endothelial growth factor A (VEGF-A)…
A: Mass spectrometers can be used to determine the structure and chemical characteristics of molecules,…
Q: binding by competing for a binding site. Explain what this means for oxygen binding capacity of…
A: RBC's with 2,3 Bisphospho glyceric acid BPG have low affinity for oxygen. when hemoglobin is…
Q: Jaundice (turning yellow) can occur with newborns and also in someone with hepatitis
A: Answer :: Jaundice is a condition that includes a change in the color of the skin, whites of the…
Q: why do gray squirrels prefer crushed walnuts than walnuts with shells?
A: Normal squirrels have four front teeth that never stop growing and make it easy for them to eat…
Q: The endomembrane system is responsible for
A: Within a eukaryotic cell, the endomembrane system is made up of several membranes suspended in the…
Q: why is it important to name organisms? Prionance glauca is sometimes referred to as the blue whaler…
A: Introduction :- A group of living organisms made up of similar individuals capable of interbreeding…
Q: For transcription to occur, the promotor region of DNA will a) Make a DNA copy of the DNA template…
A: RNA polymerase is the key central enzyme that regulates the transcription process. Prokaryotes need…
Q: Which of the following statements concerning the evolution of behavior is correct? A. Natural…
A: Behavioral evolution can include sensory system alterations, brain changes, and even physical…
Q: When does crossing over happen in chromosomes? O Meiosis Prophase O Meiosis metaphase O Mitosis…
A: Cell division is the means of reproduction in unicellular (single-celled) organisms, whereas in…
Q: 2. Hemoglobin releases protons upon oxygen binding. This phenomenon is called the Bohr effect, and…
A: Introduction Hemoglobin, often known as Hb or Hgb, is an iron-containing oxygen-transport…
Q: What is the evidence that gene duplication has been thesource of the α and β gene families for…
A: Multiple genes in the gnathostome α-globin gene clusters are derived from a common ancestral gene…
Q: BACTERIA STRAIN A IS AUXOTROPHIC FOR METHIONINE AND STRAIN B IS AUXOTROPHIC FOR LEUCINE. A. WILL…
A: Auxotrophic strains lack the property of synthesising the growth factors required for their proper…
Q: genetic influence
A: Genetic influences operate at two levels: 1.The genetic predisposition to certain diseases, 2. The…
Q: Fungi are (a) eukaryotes and opisthokonts (b) prokaryotes and opisthokonts (c) flagellate and…
A: Introduction :- Fungi are eukaryotic organisms that are non-vascular, non-motile, and heterotrophic.…
Q: What is purpose of the GMO-positive control DNA in the experience?
A: Introduction :- GMOs, or genetically modified organisms, are organisms (plants, animals, or…
Q: Show a complete circuit diagram of the model of the neuron using the specific numerical values for…
A: Electrical gradient and concentration gradient required at many places in the body for proceed many…
Q: Match
A: The above matching is worked out in the second step. Basing on the classification which includes…
Q: In order to ensure your newly designed peptide vaccine does not cause cell growth upon binding, you…
A: Melanoma is a kind of skin disease that creates when melanocytes (the cells that give the skin its…
Q: Q10. An ecologist wants to know if diversity in a forest system is likely to decrease when an…
A: Introduction Any nonnative species that significantly alters or disrupts the ecosystems it colonises…
Q: Question 10. This graph shows data on incidence of stomach cancer in Japanese people living in Japan…
A: Cancer is a disease condition in which the body's cells grow in an uncontrollable way or in a way…
Q: Which enzyme can recognize an altered base in the DNA? Group of answer choices DNA Polymerase AP…
A: There are several DNA repair mechanisms are present that are- direct repair system, excision repair…
Q: Characterize the unique nature of a lichen.
A: Introduction A lichen is a symbiotic connection between two organisms, a green alga or…
Q: If you are a small animal with limited distribution, and has a small population size, what…
A: If there's a small animal with limited distribution, and has a small population size, so combination…
Q: 1) One cell-signaling pathway implicated in the regulation of cell division is the mTOR/Akt pathway.…
A: mTOR/Akt pathway involved in cell division.
Q: (0-E}E (.6254'|4=285 Signal of Grey Squirrel Observed (0) Expected (E) High pitch honest signal…
A: The chi-square (X2) test is performed to compare the observed and expected data of an experiment.…
Q: . What are the three principles of the theory of evolutionby natural selection?
A: Introduction :- Evolution refers to the change in a species' characteristics over several…
Q: Give your own definition of each word below. 1.Taxonomy 2. Taxonomic Hierarchy 3.Systema Naturae…
A: Introduction Biological classification:- It is the process of arranging organisms, both living and…
Q: Coelochaetes (green algae) Charophytes (green algae) Ancestral green algae Bryophytes…
A: Phylogenetic tree Phylogeny is the study of the history of the evolutionary relationship between…
Q: E. coli DNA polymerase III synthesizes two new DNA strands during replication, yet it possesses…
A: DNA replication is necessary to ensure genetic continuity and genome inheritance from parents to…
Q: In the early 1940s, Oswald Avery and his team set out to identify the conditions necessary for…
A: Big and complicated macromolecules play an important part in the functioning and regulation of our…
Q: What is the effect of having fluctuating cyclin levels throughout the cell cycle, while the levels…
A: Cell cycle It is a series of events in which cell duplicate it's organelles and divide.
Q: If there are two genes (G and B) that determine the flower color of one plant (purple is dominant…
A:
Step by step
Solved in 2 steps with 1 images
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedureINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: RNA splicing is the step in post transcriptional processing where intervening sequences are removed STAMENT 2: 5’ to 3’ direction is the direction of growth of the peptide chain ANSWER: STAMENT 1: The enzyme that joins the gaps in newly synthesized DNA is called DNA polymerase STAMENT 2: The name of the compound formed when cytosine is bonded to ribose is cytidine ANSWER: STAMENT 1: Codon is a term that refers to the 3-nucleotide code for amino acids in mRNA STAMENT 2: Transition is a kind of mutation where a purine changes to another purine ANSWER:
- RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A CBriefly, be able to define each of these AND, where relevant, tell what do they do, and which process(es) are they involved in (for example, replication or translation or transcription or splicing etc.) * means can you draw it (stick figure)? A DNA, B DNA, Z DNA Aminoacyl TRNA synthetase *antiparallel (with regards to DNA) autopolyploid auxotrophic mutation base analog cancer genes (oncogenes, tumor şupp genes etc) centromere conjugation control of gene expression methods degeneracy of the genetic code DNA ligase DNA polymerase enhancer F factor
- Application/ Analysis Explain how the anti-parallel structure of DNA predicts its replication mechanism. Identify the major and minor groove of DNA and explain why they are there. Differentiate between semiconservative, conservative, and dispersive replication. Interpret a diagram of a bi-directional replication fork and correctly determine strand polarity and fork direction.DNA Replication Drawing Name: Using penci, you will draw a representation of DNA replication along the leading and lagging strands. Follow the directions below, drawing each element in its proper location along the replicating DNA strand. Once you are sure everything is in the correct place, complete your drawing by adding color to distinguish objects as separate. 1. On the diagram below, label the 5 and 3' onds of both parental DNA strands (you can make up which is which) 2 Label the replication fork 3. Draw and label helicase 4. Label the overall direction of DNA replication 5. Draw and label single stranded binding proteins 6. Draw and label the leadng strand 7. Draw and label a single DNA polymerase IIl on the leading strand 8. Draw and label an RNA primer on the leading strand 9. Draw and label a DNA polymerase I on the leading strand 10. On the lagging strand, draw and label at least three Okazaki fragments 11. On the lagging strand. draw and label at least two DNA polymerase IIl…MCQ QUESTION: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base is targeted. A- Photoreactivation repair/ b- thymine SOS repair/ C-adenine Mismatch repair/ D- cytosine Proofreading/guanine The DNA sequence (5'-ATACAMA-3') was exposed to Ethyl Methanesulfonate (EMS) which is a(n) _______ . The resulting DNA sequence will become __________ after one round of cell division.
- Explain the effect(s) the following scenarios would have on DNA replication or translation. For each scenario, state whether DNA replication or translation would be able to proceed and explain your reasoning. Low amount of 7- methyl guanosine in the nucleus low amount of DNA polymerase I lack of helicaseExplain, in detail, the process of DNA replication. Include in your answer, a diagram, the cellular location and reason for DNA replication, the names of all enzymes/molecules involved, and the sequence of events. a. Explain, in detail, the process of mRNA translation. Include in your answer, a diagram, the cellular location and reason for translation, the names of all enzymes/molecules/sites involved, and the sequence of events. Please help explain in fewer than 8 sentences!BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?