Structural Stability of DNA True or false Hydrophobic bonding between stacked purine and pyrimidine Hydrogen bonding between purine and pyrimidine bases Hydrogen bonding between adjacent pyrimidine bases tRNA True or false A given tRNA can be charged with only one particular amino acid The anticodon of tRNA finds the complementary codon on mRNA The amino acid is attached to end of tRNA The amino acid is recognized by the anticodon of tRNA
Q: IV. CENTRAL DOGMA OF MOLECULAR Suppose the following base sequence was found in a 30-base polymer:…
A: Central Dogma: Central dogma is a process by which information from DNA is converted into…
Q: Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular…
A: Answer - This tRNA would carry the amino acid Serine to the ribosome. mRNA carries codon. tRNA…
Q: Base on the structure of RNA what are the two important elements of translation and explain
A: Ribonucleic acid abbreviated as RNA is a nucleic acid that functions as the intermediate between DNA…
Q: The drug, erythropoietin (EPO) is an artificial version of a protein that is naturally produced by…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical…
A: Introduction 1. Hydrogen bonds are a type of attractive interaction between an electronegative atom…
Q: The Central Dogma Protein information cannot flow DNA Transcription back to nucleic acids RNA •…
A: The 'Central Dogma' is the process by which the instructions in the DNA are converted into a…
Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…
A: There are different types of mutations, that result in a change or no change in the protein…
Q: In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a…
A: Introduction A Base Pair Is Made Up Of Two Chemical Bases That Are Bound Together To Form A "rung Of…
Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…
A: Nucleus is the genetic centre of the cell. It contains hereditary and genetic information stored in…
Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA - MRNA 1.…
A: Information coded in the DNA is transcribed in the form of mRNA, these mRNA then translate this…
Q: During translation elongation cycle, which of the following step(s) is/are repeated for each amino…
A: Translation is a process by which proteins are synthesized from mRNA template. It involves all the…
Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…
A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…
Q: How many other codons apart from the one used could encode the last amino acid in this peptide (i.e.…
A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…
Q: If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the…
A: Genetic code are nucleotide or nucleotide sequences of nitrogenous bases which particularly specify…
Q: e transfer-RNA and the amino acid structure attached to 5' 10
A: In molecular biology and genetics,translation is a process which comes after transcription and in…
Q: Degeneracy of Genetic Code * ( Choose True if the statement is correct abourt and Degeneracy of…
A: Codon is the set of three nucleotide that encode an amino acid.
Q: DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and…
A: Codon is a base triplet that exists in DNA. DNA gets transcripted to mRNA which then translates to…
Q: Order the events of translational elongation. Follow the path of one TRNA through elongation. The…
A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…
Q: What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: In Figure 9-12(b), what do you think happens to thetRNA that is released from the E site?
A: t-RNA is responsible to bring the amino acids to the site of protein synthesis. t-RNA is charged…
Q: Noncoding Strand -> 5’ - G C C A G G T C A G G T - 3’…
A: The terms used in the question represents the molecules involved in gene expression. A gene is a…
Q: Titin is a muscle protein named for its size. Its gene has the largest known coding sequence of…
A: Genes are made of nucleic acids called DNA. The variant forms of genes are called alleles. DNA is a…
Q: tRNA enzyme. Any given aminoacyl-tRNA synthetase: a. Attaches the amino acid to the 5′-end '5end of…
A: An anticodon is a RNA triplet complementary to the triplet on mRNA coding for their cargo amino…
Q: an anticodon on one end and a site for an amino acid to attach on the other end. There is base…
A: Translation :- It is the process by which a protein is synthesized from the information contained…
Q: True or false! aug are the first 3 nucleotides synthesized during transcription in a eukaryotic…
A: Transcription in eukaryotic cells occurs in the nucleus where the DNA is packed into the nucleosome.…
Q: Which of the following statements is false about the structure of TRNA? O Because of hydrogen bonds,…
A: RNA is ribonucleic acid which is single stranded .It is of three types :- A ) mRNA B ) tRNA C ) rRNA
Q: A tRNA that has the anticodon GAG carries which amino acid?
A: tRNA is a special kind of RNA molecule. It is also called transfer RNA. tRNA or transfer RNA is…
Q: An alpha helix is a: O A. secondary structure found in proteins. O B. right-handed twist found in…
A: DNA ( Deoxyribonucleic acid) is a nucleic acid. The basic unit of DNA is the nucleotide. DNA is a…
Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA MRNA | 1.…
A: Transcription is process of formation of mRNA from DNA template by addition of complementary…
Q: tRNA True or false A given tRNA can be charged with only one particular amino acid The anticodon…
A: Transfer RNAs- Transfer ribonucleic acid is an RNA molecule that aids in the translation of a…
Q: Molecule Structure, Function diagram or description TRNA Ribosome MRNA poly-a tail
A: Transcription is the process of synthesis of RNA from DNA, using DNA as a template. It is initiated…
Q: Mutations and DNA repair. Francis Crick's "wobble pairing" hypothesis suggested an economical…
A: The process by which the information coded in RNA (mRNA) is decoded into a polypeptide is one of the…
Q: The charging of a tRNA with an amino acid can be represented by the following equation:amino acid +…
A: Translation is a biochemical phenomena in which mRNA molecule gets translated to proteins. Charging…
Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…
A: Introduction A mutation is a modification to the DNA sequence of an organism. Mutations can result…
Q: The alpha chain of human hemoglobin has 141 amino acids in a single polypeptide chain. Calculate the…
A: A codon is trinucleotide sequence of bases of DNA or RNA which corresponds to a specific amino acid.…
Q: Degeneracy of Genetic Code True False each codon specifies more than one amino acid the first…
A: Genetic code consists of nitrogenous bases such as A, G, C, G, and U.It is a triplet code that codes…
Q: Wobble base pairing allows some tRNAs to bind to more than one type of codon. If wobble base pairing…
A: Francis crick proposed the wobble hypothesis in 1966. According to which : The 5' end of anti-codon…
Q: tRNAs contain 4 arms, each characterized by the presence certain modified bases or speciic…
A: tRNA have 4 major arms and 1 variable arm. The 4 major arms of tRNA are ; D arm Anticodon arm TψC…
Q: Which of the following statements about tRNA molecules is TRUE? Multiple Choice TRNA assumes a…
A: A transfer RNA or tRNA is a special kind of RNA molecule. Work of it is to match an mRNA codon…
Q: Which statement BEST DESCRIBES the tRNA structure? Chooose from the options below. Amino acids bind…
A: Introduction :- The three hairpin loops that make up the tRNA molecule's characteristic folded…
Q: which level of structure describes non watson crick intercations in trna
A: According to Watson and crick, the DNA is a nucleotide, it is made up of sugar, nitrogenous base,…
Q: BONUS: In Bacteria, catalyzes formation of peptide bonds during translation (answers must be in…
A: RNA nucleotides are linked together by 3’-5’ phosphodiester linkages. The three min RNA in all the…
Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA MRNA 1.…
A: The 'Central Dogma' is the process which defines that the instructions in DNA are converted into a…
Q: The tRNA anticodon sequence 3’GAG 5’ is charged with the amino acid leucine. This anticodon may pair…
A: Normal complementary nucleic acid sequences bind to each other by Watson and Crick base pairing but…
Q: Frameshift Mutations A frameshift mutation involves the insertion or deletion of one or more…
A: Deletion and insertion of a nucleotide from a DNA sequence changes the nucleotide sequence which…
Q: Which of the following is NOT a general feature of tRNA? A. All TRNAS contain 4 loops, the anticodon…
A: tRNA is transfer RNA which is an adaptor molecule and assists in formation of peptide chain during…
Q: Fill in the blanks: The Lys60 (encoded by 5'-AAG-3' codon) of a protein is critical for its binding…
A: The ribonucleic acid or RNA is produced from these DNA by transcription process. Different types of…
Q: ribonucleotide double helix tRNA phosphodiester bond hydrogen bond polymer mRNA…
A: The DNA and RNA both are the examples of nucleic acids. The DNA is double stranded helical molecule…
Q: In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a…
A:
Structural Stability of DNA
True or false
- Hydrophobic bonding between stacked purine and pyrimidine
- Hydrogen bonding between purine and pyrimidine bases
- Hydrogen bonding between adjacent pyrimidine bases
tRNA
True or false
- A given tRNA can be charged with only one particular amino acid
- The anticodon of tRNA finds the complementary codon on mRNA
- The amino acid is attached to end of tRNA
- The amino acid is recognized by the anticodon of tRNA
Step by step
Solved in 2 steps
- Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. SubmitMRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.
- tRNA True or false A given tRNA can be charged with only one particular amino acid The anticodon of tRNA finds the complementary codon on mRNA The amino acid is attached to end of tRNA The amino acid is recognized by the anticodon of tRNAMRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
- Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First lettercodon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
- True or false Both pentose nucleic acid and deoxypentose nucleic acid contain the same pyrimidines Both pentose nucleic acid and deoxypentose nucleic acid and deoxypentose nucleic acid Contain the same purines RNA contains cytosine and thymine DNA and RNA are hydrolysed by weak alkali The anticodon of tRNA finds the complementary codon on mRNA The amino acid is attached to end of tRNA The amino acid is recognized by the anticodon of tRNA A given tRNA can be charged with only one particular amino acidDNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. MRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acids of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…
