Compare and contrast the following. Use you own words and be sure to incorporate key biochemical concepts from the semester. Diagrams are always welcome. A. Peptide vs. steroid hormones (mode of action is key here)
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: 5. We're back in the lab having fun! Our current experiment calls for us to treat our cells with THC…
A: A stock or standard solution is one whose concentration is precisely known. Stock solutions can be…
Q: Describe the four levels of protein in great depth. Desrcibe how protein structure may affect…
A: Proteins are biomolecules composed of amino acids. Amino acids are joined together through peptide…
Q: Consider the structure of TAMIS below and answer the questions that follow. ОН НО Н H ОН Н H ан .H.…
A: The given structure is a carbohydrate molecule having monosaccharide units joined via glycosidic…
Q: Please depict a noncovalent interaction important for the function of lysozyme
A: Lysozyme: An enzyme called lysozyme breaks down the polysaccharides in bacterial cell membranes.…
Q: Which of the following tests is used to differentiate between pancreatic insufficiency and…
A: Reduced nutrition absorption can be brought on by issues with mucosal transport or with intraluminal…
Q: Uncouplers of oxidative phosphorylation are all expect: Select one: O a. thermogenin O b.…
A: INTRODUCTION: (Oxidative phosphorylation) The process by which ATP is formed as a result of the…
Q: 3. Predict the effect of each of the following amino acid substitutions on the KM and keat of the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 4. Shown below is the structure of the anti-retroviral drug AZT. 5' HOCH, H 3 N₂ HN AZT H 12 H CH₂…
A: AZT is a drug that is used to treat HIV. HIV is a retro virus that causes the syndrome AIDS. When…
Q: How do enzymes typically relate to the manipulated variables? our manipulated variables were…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: 1. Draw the structure of the polyribonucleotide UAGCCUG. 2. Draw the structure of the…
A: Nucleotides are phosphoric acid esters of nucleosides (pentose sugar containing a nitrogenous base).…
Q: Please answer the following two questions: 1. Biochemistry and function of chylomicrons 2. The…
A: Chylomicrons are lipoproteins synthesized in the intestine. Lipoproteins are compound lipids…
Q: BIOC 384 Structure and Function of Simple Sugars Q9.1: NutraSweet (aspartame) is not a carbohydrate…
A: Carbohydrates are organic molecules that are composed of carbon, hydrogen, and oxygen. They are…
Q: Given: Beer-Lambert Law A = Ecl E = 8000 for Met myoglobin E= 14,000 for oxy-myoglobin l=1 cm…
A: According to Beer-Lambert law the concentration of the sample is directly proportional to the…
Q: Mucic Acid Test for Galactose and Lactose Galactose, on being oxidized with HNO3 forms mucic acid,…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified into monosaccharides,…
Q: The pentose phosphate pathway occurs in the mitochondrion of tissues actively engaged in synthesis…
A: Introduction: The pentose pathway is also known as the hexose monophosphate shunt (HMP) or…
Q: 3- True or False: A given reaction, such as the hydrolysis of ATP can do a set amount of…
A: Adenosine triphosphate, or ATP, is a small molecule. It can be viewed as the primary energy currency…
Q: A pentapeptide has the abbreviation "GREAT". Draw the peptide and give its systematic name.
A: Peptides are short sequences of amino acids. Amino acids in a peptide are joined together through…
Q: One of your colleagues has obtained a sample of muscle phosphorylase b that is known to be…
A: Glycogen is storage-type homopolysaccharides that contain two types of glucose polymers: amylose:…
Q: In the Krebs cycle, the energy released by taking a compound off Coenzyme A is used to: Group of…
A: There are 2 two reactions in Krebs cycle were a compound is taken off Coenzyme A (CoA-SH). These two…
Q: 3. After the competition, the athlete's lactic acid content is 4 mmol/l. Can this be considered a…
A: Lactate is created more quickly and cannot be removed, it builds up in muscle fibers. Lactate is a…
Q: d. What type of inhibition is exhibited against NAD* as a cofactor? Describe what is going on in…
A: There are three types of inhibitors-competitive, non-competitive and uncompetitive. In competitive…
Q: Determine the direction that each of the reactions will progress. Assume that the reactants and…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: . What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: DNA is the genetic material in most organisms. During transcription RNA Polymerase synthesizes the…
Q: true/false: The majority of the urea cycle occurs in the cytosol of cells
A: In the mitochondria of liver cells, the urea cycle or ornithine cycle converts excess ammonia to…
Q: With regards to hemoglobin-oxygen binding, CO2 is a [Select] modulator and 2,3-bisphosphoglycerate…
A: Positive allosteric modulators of haemoglobin -oxygen binding are the agents that stabilise R state…
Q: The Gs-alpha subunit of trimeric G proteins can function to regulate ion channels. inhibit…
A: Introduction: G-protein is a heterodimeric containing three different subunits named alpha, beta,…
Q: Which of the following is a structure of a sugar alcohol? Н I I H O CAB O CAR O CAP COOH OH нон CAT…
A: Sugar alcohols are formed when the aldehyde or keto group of the monosaccharide is treated with a…
Q: 3. Researchers purified a new enzyme and during an initial characterization determined the Vmax to…
A: Enzyme inhibition is when an inhibitor bind to the enzyme at the active site or another site, which…
Q: 3. Attach the structures below to draw a sphingolipid. CH3-(CH2) 12-CH=CH-CH-OH sphingosine CHINH,…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: b-oxidation occurs ONLY under aerobic conditions. Why? Glycolysis occurs under anaerobic conditions,…
A: Beta-oxidation of fatty acids is the process by which long chain fatty acid molecules are broken…
Q: (a) Which antibacterial compound does NOT directly inhibit this process? H₂N NH cycloserine A Ph…
A: The given park nucleotide consist of five amino acids linked by peptide bond with sequence of…
Q: Biochemistry Plz answer these 2 question 1. How to differentiate between beta-amylase from alpha…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Could you please explain in detail why they end up in aspartate? Illustrations with 14C labelled…
A: All the metabolic reactions occurring inside the living system provides energy and replenishes the…
Q: Experiment: DNA Extraction from Banana The procedures are attached below. Question: 1. Will the…
A: DNA is the genetic material that is presented inside the nucleus of every cell. Banana is the best…
Q: The substitution of His 64 of carbonic anhydrase II with Ala results in a sharp decrease in the…
A: Carbonic anhydrase II is the enzyme that catalyzes the formation of H2CO3 from CO2 and H2O, and…
Q: Which reaction below in the glycolytic pathway has a highly unfavorable delta Gº¹ but a favorable…
A: Free energy changes: The Gibbs free energy is used to calculate the maximum amount of work that a…
Q: Which of these is NOT true of nucleosomes? A. Some post-translational modifications to histone…
A: Nucleosome is the basic subunit of chromatin. It is the basic unit of DNA packaging. Nucleosomes…
Q: A researcher found that a single point mutation in the genome of the SARS-CoV-2 virus resulted in a…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Which of the designations are accurate for the fatty acid?
A: Simple fats or triglycerides are fatty acid esters of glycerol, where three fatty acid molecules are…
Q: Choose the best answers for each missing word from the list below. (1)__________ is a first…
A: Biochemical cell signalling is the method by which cell communicates with each other cells and…
Q: I have built an urn model for a DNA sequence. I have taken the letters from a sequence 1946…
A: DNA is composed of sequence of nucleotides (adenine, thymine, guanine and cytosine) linked by 3-5…
Q: How many NET molecules of ATP are produced during the Embden-Meyerhof pathway of glycolysis for…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: How many ADP molecules are phosphorylated as electrons of cytosolic NADH enter the mitochondria via…
A: Most textbooks mention that under aerobic conditions, NAD+ is regenerated in the ETC. But the…
Q: Upon doing the experiment of Protein Denaturation, what could be observed in the precipitation of…
A: When a protein solution is boiled, the protein frequently becomes insoluble (i.e., denatured) and…
Q: Compare and contrast biochemical pathways. Describe the chemistry of the last three steps of the…
A: The citric acid cycle involves the oxidation of acetyl-CoA into CO2 and H2O. The beta-oxidation is…
Q: Please describe four different modes of the regulation of the pentose phosphate pathway.
A: Introduction:- The Question is all about the pathway of pentose phosphate cycle that synthesis via…
Q: The structure of a metalloenzyme active site is down below(black picture). Describe, from a chemical…
A: Methane monooxygenase (MMO) is present in methanotrophic bacteria and MMO is present in an integral…
Q: You run an SDS-PAGE gel on some purified protein samples against a protein ladder as marked. kDa 225…
A: SDS PAGE is an electrophoretic technique, which is used to separate proteins based on their size.…
Q: Use the metabolite concentrations in the table to calculate the AG of the reaction above. Report…
A: Dihydroxyacetone (DHA) catalyzed into glycerol reversibly by enzyme glycerol dehydrogenase. NADH…
Step by step
Solved in 2 steps
- Please answer. Try your best :)Answer briefly and concisely. a. Some athletes eat diets high in carbohydrates before an event. Suggest a biochemical basis for this practice. b. The concentration of lactate in blood rises sharply during a sprint and declines slowly for about an hour afterward. What causes the rapid rise in lactate concentration? What causes the decline in lactate concentration after the run?elearn.squ.edu.om/mod/qui ystem (Academic) The enzyme asparaginase is used to reduce the level of asparagine in blood in the treatment of leukemia. Which of the following forms of Asparaginase would be most useful if the blood asparagine level is 0.2 mM? Select one: O a. Km = 2.0 mM; Vmax = 0.1 mM/hour O b. Km = 0.1 mM; Vmax = 0.5 mM/hour %3D О с. Кm 0.2 mM; Vmax = 0.1 mM/hour O d. Km = 0.1 mM; Vmax = 0.1 mM/hour O e. Km = 0.2 mM; Vmax = 0.5 mM/hour Clear my choice In a steady state (of ES formation and ES breakdown) Select one: a The rate of formation of ES is equal to the rate of its degradation during the reaction
- Asap I need both answer. Please explain both why answer is correct. Advance thank youGreg Tobin mixes together three types of vitamintablets. Each Super Vim tablet contains, among other things,15 mg of niacin and 12 I.U. of vitamin E. The figures for aMultitab tablet are 20 mg and 15 I.U., and for a Mighty Mix are25 mg and 35 I.U. How many of each tablet are there if the totalnumber of tablets, total amount of niacin, and total amount ofvitamin E are as follows?a. 225 tablets, 4750 mg of niacin, and 5225 I.U. of vitamin Eb. 185 tablets, 3625 mg of niacin, and 3750 I.U. of vitamin Ec. 230 tablets, 4450 mg of niacin, and 4210 I.U. of vitamin EAnser in your own words. a. During pregnancy, do mother and child share the same blood? What if they have different blood types? b. If a patient takes a large dose of a drug that blocks calcium channels, what happens to the heart? c. The enzymes of the digestive system are classified as hydrolases. What does this mean? d. Explain in a scientific but simple manner the idiomatic expression “butterflies in my stomach”.
- In expressing therapeutic proteins (check all that apply): O Bacteria could be used if you want the protein's disulfide bonds formed before secretion from the bacterial cell. The N-terminal signal sequence and the C chain of insulin must be cleaved off in the rough ER before it's active. O Proteolytic protein maturation can be performed by mammalian cells. □ One of the required modifications to preproinsulin, before it's mature, is glycosylation. Both preproinsulin and proinsulin are inactive proteins.Directions: Read and understand each question. Choose the letter of your bestanswer. 1. Cells need energy to perform their works. What type of energy is used by the cell?A. Adenosine triphosphate C. Adenosine monophosphateB. Adenosine diphosphate D. All of these 2. Which of the following works is/are performed by the cells?A. Muscle contractions C. Making polymersB. Pumping across membranes D. All of these 3. Which of the following is/are component/s of ATP?A. Nitrogenous base C. Phosphate groupB. Ribose sugar D. All of these This is not a Writing AssignmentA nurse is caring for a patient with refractoryepilepsy. To enhance medical management,a ketogenic diet has been prescribed. Ineducating the patient about dietary energysources, all of the following statements aretrue, except:a. Proteins consist of polymers of nucleic acids.b. Fat provides more kilocalories per gram thanprotein.c. A high-fat diet may cause increased serumcholesterol levels.d. Starch is an example of a carbohydrate.
- Give typed full explanation Regular insulin is ordered IV at 5 units per hour. The IV bag contains 100 units of regular insulin in 100mL of NS. What should the IV rate be?show workings. child who N goh fur 2 A physician order s gentamycin 4o weighs kgl day a what The recommended d03age fur children is 3 -bmg / よ、deddoses. 24 1bs. three maseimum daily dosges the recommended mininmum ĕ are for this cしいは? magcinmum Single b) what are the recommended dos ages for this child? c) is ordered dos age safie ? theCan Please Help Me: Bio- Chemistry 60 minutes only the given time. Wish you could help me. I will give UPVOTE and GOOD FEEDBACK. QUESTION/// Diisopropyl fluorophosphate (DFP) inhibit acetylcholinesterase activity by reacting covalently to a serine residue found within the active site of the enzyme. The physiological effect of this inactivation is interference with neurotransmitter inactivation at the synapses of nerves, resulting in the constant propagation of nerve impulses, which can lead to death. What type of inhibitor is DFP? Explain. ///QUESTION