A gene is transcribed in a fibroblast and a chondrocyte, but the primary structure of the encoded peptide is different in the two cells. In the fibroblast, there appears to be missing amino acids at the C-terminus. Which of the following could be the cause of this difference in the fibroblast? O A. Leaky scanning is occurring O B. No cap is being added to the pre-MRNA OC. There is an increase the length of the poly-A tail D. There is a decrease the length of the poly-A tail O E. An alternative Poly-A site is being used

A gene is transcribed in a fibroblast and a chondrocyte, but the primary structure of the encoded peptide is different in the two cells. In the fibroblast, there appears to be missing amino acids at the C-terminus. Which of the following could be the cause of this difference in the fibroblast? O A. Leaky scanning is occurring O B. No cap is being added to the pre-MRNA OC. There is an increase the length of the poly-A tail D. There is a decrease the length of the poly-A tail O E. An alternative Poly-A site is being used

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?
Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is isolated, and analysis shows a nonsense mutation located near the 3' end of the coding region. The 3' terminal coding sequence of the abnormal mRNA strand is shown below. 5`- AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG-GGC-GGA-AAA-UUU-UAA-3` Write down the tRNA anticodon responsible for adding the last amino acid?
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…
thank you
1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence, transcribe this gene i.e a) write out that sequence of the mRNA you will make from turning on this gene Z b) Label the 5' and 3' ends of the mRNA made 2) Assuming there is a ribosome binding site for the mRNA you just synthesized in the previous question, write out the amino acid sequence of this protein Z that is made (Using the genetic discord Mary provided) The following double stranded DNA sequence provided contains a gene for making proteins Z. The regulatory sequence or switch is indicated by the Red colored sequences. Start of transcription is 10 nucleotide after the switch sequence beginning at the Blue region. Answer the following questions. 3'. TATGACAACGCGTATAATCCAGTCGGTTTGGGGGTAATTGGGCGTCCTACGTCTACAAAGGGTCGTT ААТAGCATTTAGGCGTсTGCCTTTTAТCGTTTATCGAATTтсТТАТTАTTTTAATстCсT...5 5'.ATACTGTTGCGCATATTAGGTCAGCCAAACCCCCATTAACCCGCAGGATGCAGATGTTTCCCAGCAAT…
AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acids
CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out) 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter) 3. Look up for each tRNA codon and find the corresponding symbol and amino acid abbreviations. The symbols should spell out a meaningful English message.
CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out)