Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 22, Problem 7EQ
Summary Introduction
To review:
Reverse genetics is the opposite of conventional genetic study of gene function.
Introduction:
The conventional study of gene function includes identification of gene because of an altered
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
In the study of plants and animals, it is relatively common forresearchers to identify a gene using molecular techniques withoutknowing the function of the gene. In the case of mice, the functionof the gene can be investigated by making a gene knockout. Aknockout that causes a phenotypic change in the mouse may providean important clue regarding the function of a gene. For example,a gene knockout that produced an albino mouse would indicate that the knocked-out gene probably plays a role in pigment formation. The experimental strategy of first identifying a gene based on its molecular properties and then investigating its function by making a knockout is called reverse genetics. Explain how this approach is opposite to (or the reverse of) the conventional way that geneticists study the function of genes.
You are interested in studying a novel gene that appears to be involved in cancer. There is no information about the function of this gene. What would you do to obtain the cDNA for this gene? How would you express this gene and what expression systems might you utilize to study its function and why? How would determine the subcellular localization of this gene in eukaryotic cells? What are alternative methods in case one doesn't work? How would you purify and determine the 3-dimensional structure of this protein?
During experimental RNAi, how does the researcher affect expression of a target gene?
Group of answer choices
Inject custom, lab-made double-stranded RNA into the specimen that will be targeted by the cell's existing Dicer to create siRNA complementary to the target gene's transcript.
Inject lab-made Dicer proteins into the specimen which will cut up the target gene's transcript.
Inject custom, lab-made siRNAs complementary to the target gene's transcript.
Chapter 22 Solutions
Genetics: Analysis and Principles
Ch. 22.1 - 1. Which of the following uses of microorganisms...Ch. 22.1 - Prob. 2COMQCh. 22.1 - Prob. 3COMQCh. 22.2 - When a cloned gene is inserted into a noncritical...Ch. 22.2 - Prob. 2COMQCh. 22.3 - Prob. 1COMQCh. 22.3 - Prob. 2COMQCh. 22.4 - Prob. 1COMQCh. 22.4 - Prob. 2COMQCh. 22.5 - A means of introducing a cloned gene into cells...
Ch. 22.5 - 2. Which of the following best describes the...Ch. 22 - 1. What is a recombinant microorganism? Discuss...Ch. 22 - Prob. 2CONQCh. 22 - 3. What is bioremediation? What is the difference...Ch. 22 - Prob. 4CONQCh. 22 - Prob. 5CONQCh. 22 - Prob. 6CONQCh. 22 - 7. What is a transgenic organism? Describe three...Ch. 22 - Prob. 8CONQCh. 22 - Explain the difference between gene modification...Ch. 22 - As described inChapter 5, not all inherited traits...Ch. 22 - Prob. 11CONQCh. 22 - 12. Discuss the concerns that some people have...Ch. 22 - Prob. 1EQCh. 22 - 2. Bacillus thuringiensis makes toxins that kill...Ch. 22 - Prob. 3EQCh. 22 - Prob. 4EQCh. 22 - Prob. 5EQCh. 22 - What is a gene knockout? Is an animal or plant...Ch. 22 - Prob. 7EQCh. 22 - Evidence [see P. G. Shiels, A. J. Kind, K. H....Ch. 22 - Prob. 9EQCh. 22 - 10. What is reproductive cloning? Are identical...Ch. 22 - Researchers have identified a gene in humans that...Ch. 22 - Treatment of adenosine deaminase (ADA) deficiency...Ch. 22 - Several research studies are under way that...Ch. 22 - Prob. 1QSDCCh. 22 - 2. A commercially available strain of P....Ch. 22 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The sequencing of entire genomes has made it possible to examine the level of gene expression in a particular cell or tissue by using oligonucleotide probes to assess the mRNA expression level from a particular gene. This is done most effectively through the use of what experimental technique?arrow_forwardWhat is the first step in quantifying the relative amounts of mRNA in different tissues? Would this method be useful in determining which immune system genes might be over-expressed in severe Covid cases? Why or why not? Could quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells? One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive. It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in…arrow_forwardIn the bacteriophage T7 system used to express recombinant proteins, the gene of interest is fused to T7 promoter and T7 RNA polymerase is separately cloned into the same cell. What is the main reason this system uses T7 RNA polymerase instead of relying on the bacterial RNA polymerase? To restrict the expression of bacterial protein expression To enhance the amount of recombinant protein expression To enhance the expression of bacterial protein expression To restrict the amount of recombinant protein expression To enable the expression of T7 viral protein expressionarrow_forward
- Let's say: a drosophila melanogaster line is bred in a lab, which has a phenotypic variation of interest resulting from the wingless gene (wg1) . Firstyly: how you would go about identifying SNP variants in this gene? and Secondly: what method could you use to eliminate the possibility that this phenotype results from other gene regulatory elements?arrow_forwardSeveral research studies are under way that involve the use of genetherapies to inhibit the growth of cancer cells. Oncogenes are mutant genes that are overexpressed and cause cancer. New gene therapies are aimed at silencing oncogenes by producing antisense RNA that recognizes the mRNAtranscribed from oncogenes. Based on your understanding of antisense RNA , explain how this strategy would prevent the growth of cancer cells.arrow_forwardGene expression can be disrupted by techniques such as homologous recombination and RNA interference. What is the functional difference between these two methods in terms of the ultimate effect on gene expression? Why might homologous recombination or an alternative genome-editing method (e.g., CRISPR/Cas9) be preferred over RNA interference?arrow_forward
- PROTEIN X HAS THE POTENTIAL FOR MEDICAL APPLICATION IN HUMAN. IT IS ORIGINALLY FROM A PLANT AND HAD BEEN SUCCESSFULLY CLONED FROM ITS GENE. AFTER MANY ATTEMPTS TO CLONE IT INTO EUKARYOTIC EXPRESSION VECTORS WERE UNSUCCESSFUL, THE RESEARCHER DECIDED TO USE E.COLI EXPRESSION VECTOR. HOW THE RECOMBINANT PROTEIN COULD BE EXPRESSED IN E.COLI EXPRESSION VECTOR.1. FACTORS AFFECTING BACTERIAL EXPRESSION SYSTEM.2. STRATEGIES TO IMPROVE THE PROTEIN EXPRESSION.3. WAYS TO ENSURE THE PROTEIN IS ACTIVELY PRODUCED.arrow_forwardA) List the steps for gene expression in prokaryotes and eukaryotes. B) Relate the differences in gene expression between prokaryotes and eukaryotes in gene expression regulation and explain what causes those differences.arrow_forwardthere is the statement: "Both stem cells and specialized cells have all the same genes. They differ in the regulation of those genes and express very different sets of genes ". Which one of the following explanations best accounts for this difference in stem cell and specialized cell gene expression? A. Stem cells and specialized cells have different activators and repressors that affect transcription B. Stem cells and specialized cells have different promoter sequences for their genes, thus affecting transcription C. Stem cells and specialized cells have different ribosomes that affect translation D. Stem cells and specialized cells use different start codons on mRNAs, thus affecting translationarrow_forward
- By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forwardMicroarrays can be used to determine relative levels of gene expression. In one type of microarray, hybridization of red (experimental) and green (control) labeled cDNAs is proportional to the relative amounts of mRNA in the samples. Red indicates the overexpression of a gene and green indicates the underexpression of a gene in the experimental cells relative to the control cells, yellow indicates equal expression in experimental and control cells, and no color indicates no expression in either experimental or control cells.In one experiment, mRNA from a strain of antibiotic-resistant bacteria (experimental cells) is converted into cDNA and labeled with red fluorescent nucleotides; mRNA from a nonresistant strain of the same bacteria (control cells) is converted into cDNA and labeled with green fluorescent nucleotides. The cDNAs from the resistant and nonresistant cells are mixed and hybridized to a chip containing spots of DNA from genes 1 through 25. The results are shown in the…arrow_forwardThis image shows the alignment of the promoter from the same gene (gene H) across multiple mammalian and bird species. Predict how the following two mutations will affect the amount of gene expression from gene H in M. musculus (the mouse, underlined with a blue line). A) The T marked by the first arrow is mutated to a G. This will ______expression of gene H. Increase decrease Abolish Not change B) The G marked by the second arrow is mutated to a A. This will _____expression of gene H. Increase decrease Abolish Not changearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
An Introduction to the Human Genome | HMX Genetics; Author: Harvard University;https://www.youtube.com/watch?v=jEJp7B6u_dY;License: Standard Youtube License