By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false. True or False? You may find a 2 bp deletion just 5’ to the PAM site You may find a 5 bp insertion just 5’ to the PAM site You may find a 15 bp deletion that includes the PAM site You will always generate a frame shift if you target an exon

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

Related questions

Question

By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.

You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?

You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?

5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’

3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’

After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.

	True or False?
You may find a 2 bp deletion just 5’ to the PAM site
You may find a 5 bp insertion just 5’ to the PAM site
You may find a 15 bp deletion that includes the PAM site
You will always generate a frame shift if you target an exon