Human Biology (MindTap Course List)
11th Edition
ISBN: 9781305112100
Author: Cecie Starr, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Question
Chapter 21, Problem 8SQ
Summary Introduction
Introduction: Genetic code is a standard table that gives information about the standard set of codons containing three
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What potential polypeptides can be produced from the following mRNA sequence? There are more than one answer..
5’ ...GGAGCUCGUUGUAUU... 3’
a. ser-ser-leu-tyr
b. leu-cys-cys-ser-arg
c. gly-ala-ser-trp-ile
d. gly-ala-arg-cys-ile
e. glu-leu-val-val
f. You can't translate without a start codon.
I know (d) is one of the answer but I'm stuck on how to find the rest. Please help.
The peptide hormone oxytocin induces labor by stimulating the concentration of uterine smooth muscle. Its amino acid sequence is as follows: Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly.Write a messenger RNA sequence for that sequence. Write the sequence of the two strands of DNA nucleotides that carry the information. for that protein.
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’
a. What is the complementary strand?
b.Deduce the mRNA in this coding region.
c.What is the amino acid sequence based on this mRNA?
d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Knowledge Booster
Similar questions
- Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardAnalyze the following amino acid sequence and write down a potential mRNA sequence from which this sequence might have been translated. Use the codon table in your book to determine a possible mRNA sequence. Amino Acid Sequence 1: H3N+-Methionine-Valine-Histidine-Leucine-Threonine-Proline-Glutamic Acid-Glutamic Acid-COO- (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid Sequence 1? Amino Acid Sequence 2: H3N+-Methionine-Valine-Histidine-Leucine-Threonine-Proline-Valine-Glutamic Acid-COO- (b) Write a potential mRNA sequence for Amino Acid sequence 2, using the same codons for any given amino acid if it is present in both sequences.arrow_forwardFor the following mRNA sequence (reading from left to right) what will be the amino acid sequence following translation? (Use chart provided) AUGCCAGUUGAAUAA A. Pro-Val-Met-Leu-His B. Met-Val-Tyr-Pro C. Met-Pro-Val-Glu D. Correct answer not given E. Met-His-Phe-Ala-Argarrow_forward
- Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…arrow_forwardConsider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…arrow_forwardThe template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forward
- Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardWhat is the first amino acid encoded in your protein? A. Methionine B. Asparagine C. Proline D. Cysteine Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…arrow_forwardA number of fragments that will be formed by cleaving the peptide Met-Ala-Lys-Met-Arg-Phe-Met-Asn by using CNBr is O a. three O b. four O c. five O d. twoarrow_forward
- What is the correct amino acid sequence for the mRNA code AUGCCAGUAUGA answer choices A. Tyr-Gly-His B. Met-Pro-Val C. Met-Pro-Ala-Val D. Tyr-Gly-Arg-Hisarrow_forwardA fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.arrow_forwardWhich of the following is the mRNA coding for the peptide trp-met-gly- ser-his? A. 5'GGUGUAUGGUCUUAC-3' B. 5'-CAUUCUGGUAUGUGG-3' C. 5'-UGGAUGGGUUCUCAU-3' D. 3'-UGGAUGGGUUCUCAU-5' E. cannot be determined since the genetic code is degeneratearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning