Human Biology (MindTap Course List)
11th Edition
ISBN: 9781305112100
Author: Cecie Starr, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21, Problem 3RQ
Summary Introduction
To explain: The way in which polypeptide chains of proteins that are specified by DNA assembled.
Introduction: Deoxyribonucleic acid (DNA) is the genetic material of prokaryotes, archaea, eukaryotes, and some viruses. Proteins are major macromolecules made of several amino acid micro molecules and have a wide array of functions. The proteins are
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
how are the polypeptide chains of protiens that are specified by dna assembled?
What is exact location of centrosome?
what is centrosome?
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In what ways are the structures of an α helix in a protein and thedouble helix of DNA similar, and in what ways are theydifferent?arrow_forwarda) Identify three types of RNA and provide a description of each and the role they play in protein synthesis. (6 marks) b) Use the DNA sequence below to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? (1 mark) What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? (1 mark) Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence. (2 marks) Paragraph I A + v ... Lato (Recom... v 19px ... v Add a File Record Audio Record Video MacBook Pro G Search or type URL #3 2$ & ( 3 4 7 8 9 山訓 < COarrow_forwardHow long is an α-helix that contains 74 amino acids?arrow_forward
- What are two major similarities between protein synthesis in bacteria and in eukaryotes? What are two major differences?arrow_forwardWhat are the two main steps to protein synthesis and where do they take place? What are the different types of RNA used and what are their roles? How important is nucleotide order to the process?arrow_forwardWhat is role of polysome?arrow_forward
- How many proteins are there in a typical eukaryotic (nu- cleated) cell?arrow_forwardWhich type of information about the nucleotide sequenceof the target DNA is required ?arrow_forwardWhat factors ensure accuracy in protein synthesis? How does the level of accuracy usually attained in protein synthesis compare with that of replication or transcription?arrow_forward
- a) How to transfer biological information in protein synthesis? What is the link between DNA and proteins? What role does RNA play in each? Explain the protein synthesis.arrow_forwardWhen glycoproteins are synthesized in the cell, at what stage of the polymerization of the protein are the sugar groups added: Prior to translation, cotranslationally, or posttranslationally?arrow_forwardA DNA strand consists of any sequence of four kinds of nucleotides. Suppose there were only 14 different amino acids instead of 20. Which of the following statements would be correct descriptions of the minimal number of nucleotides necessary to create a genetic code? a) 1 b)2, provided that chain termination does not require a special codon c) 3, provided that chain termination does require a special codon d)2, no matter how chain termination is accomplished e) Both b and carrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY