Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 16, Problem 11RQ
Which of the following are true of epigenetic changes?
- allow DNA to be transcribed
- move histones to open or close a chromosomal region
- are temporary
- all of the above
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Which of the following is true about epigenetic modifications?
-Epigenetic modifications always repress transcription
-Epigenetic modifications are irreversible
-Epigenetic modifications only occur on the tails of histone proteins
-Epigenetic modifications influence the relationship between DNA and
histone proteins
Define Epigenetic changes. Are epigenetic changes the same thing as mutations? Explain why or why not.
Epigenetic phenomena involve
DNA methylation and histone acetylation
genetic mutation
chromosomal rearrangements
gene inversions
Chapter 16 Solutions
Biology 2e
Ch. 16 - Figure 16.5 In E. coli, the tip operon is on by...Ch. 16 - Figure 16.7 In females, one of the two X...Ch. 16 - Figure 16.13 An increase in phosphorylation levels...Ch. 16 - Control of gene expression in eukaryotic cells...Ch. 16 - Post-translational control refers to: regulation...Ch. 16 - How does the regulation of gene expression support...Ch. 16 - If glucose is absent, but so is lactose, the lac...Ch. 16 - Prokaryotic cells lack a nucleus. Therefore, the...Ch. 16 - The a/a operon is an inducible operon that...Ch. 16 - What are epigenetic modifications? the addition of...
Ch. 16 - Which of the following are true of epigenetic...Ch. 16 - The binding of _____ is required for transcription...Ch. 16 - What will result from the binding of a...Ch. 16 - A scientist compares the promoter regions of two...Ch. 16 - Which of the following are involved in post...Ch. 16 - Binding of an RNA binding protein will the...Ch. 16 - An unprocessed pre-mRNA has the following...Ch. 16 - IS. Alternative splicing has been estimated to...Ch. 16 - Post-translational modifications of proteins can...Ch. 16 - A scientist mutates elF-2 to eliminate its GTP...Ch. 16 - Cancer causing genes are called transformation...Ch. 16 - Targeted therapies are used in patients with a set...Ch. 16 - Name two differences between prokaryotic and...Ch. 16 - Describe how controlling gene expression will...Ch. 16 - Describe how transcription in prokaryotic cells...Ch. 16 - What is the difference between a repressible and...Ch. 16 - In cancer cells, alteration to epigenetic...Ch. 16 - A scientific study demonstrated that rat mothering...Ch. 16 - Some autoimmune diseases show a positive...Ch. 16 - A mutation within the promoter region can alter...Ch. 16 - What could happen if a cell had too much of an...Ch. 16 - A scientist identifies a potential transcription...Ch. 16 - Describe how RBPs can prevent miRNAs from...Ch. 16 - How can external stimuli alter...Ch. 16 - Protein modification can alter gene expression in...Ch. 16 - Alternative forms of a protein can be beneficial...Ch. 16 - Changes in epigenetic modifications alter the...Ch. 16 - A scientist discovers a virus encoding a Protein X...Ch. 16 - New drugs are being developed that decrease DNA...Ch. 16 - How can understanding the gene expression pattern...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Suppose you exert a force of 180 N tangential to a 0.280-m-radius 75.0-kg grindstone (a solid disk). (a)What to...
College Physics
Define histology.
Fundamentals of Anatomy & Physiology (11th Edition)
1. ___ Mitosis 2. ___ Meiosis 3. __ Homologous chromosomes 4. __ Crossing over 5. __ Cytokinesis A. Cytoplasmic...
Microbiology with Diseases by Body System (5th Edition)
Which of the following traits would you expect to be inherited as quantitative traits? a. body weight in chicke...
Genetic Analysis: An Integrated Approach (3rd Edition)
1. Which is a function of the skeletal system? (a) support, (b) hematopoietic site, (c) storage, (d) providing ...
Anatomy & Physiology (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Define epigenetics. Are all epigenetic changes passed from parentto offspring? Explain.arrow_forwardWhich of the following epigenetic changes could lead to reduced transcription of a particular gene?. Please make sure to select all correct answersarrow_forwardTransmission of information that is not contained within the sequence of DNA to daughter cells at cell division is called epigenetic inheritance. true falsearrow_forward
- The following is true about epigenetic gene control: O epigenetic changes to the chromatin may result from childhood development epigenetic changes to the chromatin may result from chemicals in the environment O epigenetic changes to the chromatin may result in cancer O An example of a chromatin change is DNA methylation that prevents gene expression from that area of the DNAarrow_forwardWhich of the following is a correct statement about epigenetics? Group of answer choices Increased methylation of histones = decreased gene expression Decreased acetylation of histones = increased gene expression Adenine nucleotides are often directly methylated in vertebrate genomes Guanine nucleotides are often directly acetylated in vertebrate genomesarrow_forwardEpigenetic marks regulate gene expression. Which epigenetic mark is NOT associated with positive gene expression? Histone acetylation Histone Methylation De-methylated DNA Methylated DNAarrow_forward
- In your own words, explain epigenetics. What is it? What are the main epigenetic marks? What do they do in terms of gene transcription? What are the enzymes involved?arrow_forwardSince all cells contain the same number of chromosomes and the overall same/similar genome how would the genome in a nerve cell work differently than the genome of a muscle cell? In other words what epigenetic processes cause these differences between cell types at the molecular levelarrow_forwardWhich of the following statements does not accurately complete this statement: An epigenetic trait _________. can be passed from mother cell to daughter cell by mitosis can be passed to the next generation by meiosis is a change in the DNA sequence causes changes in gene expression All are accurate Of the following, which is a good example of epigenetic changes? methylation of DNA bases addition of acetyl groups to histones CpG islands imprinting of genes All are good examples of epigenetic changesarrow_forward
- What is the abbreviated name of the human gene that contains the following sequence CAGATTGTGAAGAGGTCTCTTGA? ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3arrow_forwardAlthough each cell in your body contains the same set of genes, the genes that are “turned on” differ depending on the type of cell. What signals different genes to be “turned on” or transcribed in different cells? What types of behaviours or environmental circumstances can lead to changes in an individual’s epigenome? Explain. 3. Explain how changes in your epigenome can alter the DNA of your future children before they are even born. 4.) Explain TWO implications of these findings for society. (Hint: think big! Implications for how disease is transmitted, intergenerational trauma, the cycle of poverty, etc.)arrow_forwardDefine an epigenetic phenomenon.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY