You isolate a peptide that has the sequence Met-Val-Arg-Gln-Leu-Tyr-Lys-Trp Predict whether the mutations below will stabilize, destabilize, or have no effect on the helical tendency of the peptide. In one sentence, for each mutation, briefly explain why. a) M1A b) 7R
Q: Polymerase with H2N-...GMMTVPPKKKRVGMMTV...-COOH Provide the amino acid sequence of the signal…
A: The amino acid sequence of the signal peptide is-…
Q: In order to sediment mitochondria, you were asked to centrifuge at an RPM of 5600 to give an RCF of…
A: The relative centrifugal force (RCF) is the radial force that is generated in a spinning rotor that…
Q: Suppose that a G protein undergoes a mutation that allows the exchange of GTP for GDP to occur even…
A: Glucagon is a peptide hormone released from the alpha-islets of Langerhans of the pancreas. Glucagon…
Q: Which of the following statements about enzyme regulation is incorrect? Feedback inhibition is a…
A: Enzyme regulation is either increasing or decreasing the enzyme's activity by using a effector…
Q: DNA polymerase contains an arginine residue that is important for binding to DNA. Mutations were…
A: DNA polymerase contains an arginine residue that is important for binding to DNA. Mutations were…
Q: A. Experimental Results Sample No. 1 2 3 4 5 *Enter qualitative observations Table 1. Results of the…
A: Sample No. 1- Lactose Sample No. 2- Fructose Sample No. 3- Starch Sample No. 4- Ribose Sample No. 5-…
Q: A biochemist is trying to determine the type of proteases they have isolated from walrus blubber.…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: how many hydrogen bonds can form between amino acid and water molecules
A: Water molecule has two Hydrogen atoms attached to two electronegetive oxygen and two loan pairs .
Q: The Threshold Effect is...: O ...observed in enzymes with a large value of T. O...observed when a…
A: The subunits of an oligomeric protein ( a protein containing multiple subunits ) can exist in either…
Q: Are both statements true? 1. Heterogeneous RNA is a term that refers to mRNA that has not been…
A: As you have posted more than one question we will solve first question for you as per the…
Q: ou have a polypeptide chain that is linked by disulfide bond. If beta-mercaptoethanol is applied,…
A: A polypeptide chain that is linked by disulfide bond. If beta-mercaptoethanol is applied, there is…
Q: Which among the following catalyse dehydration step in the TCA cycle ○ Isocitrate dehydrogenase O…
A: The acetyl CoA molecules synthesized through oxidative decarboxylation of pyruvate enter into the…
Q: Cerebroside does not contain Fatty acid chain Sphingosine Polypeptide chain Sugar Next
A: Cerebrosides : Common name for the glycosphingolipids group known as monoglycosylceramides
Q: Briefly explain why fetal Hb has a higher affinity for O2 when compared to the adult Hb
A: The haemoglobin pigment, which is found in red blood cells and gives blood its red colour, is known…
Q: Which amino acid is predominantly used to add an NH2 moiety during the de novo biosynthesis of…
A: Denovo synthesis of Nucleotides referes to the process of Synthesis of nucleotides from simple…
Q: The following has the lowest energy per gram when oxidized Carbohydrate protein O ethanol O Lipids O
A: Nutrients are the compounds that provide us energy when they are oxidised. These nutrients like…
Q: write true if the statement if correct and change the " " word/phrase to make it correct in the…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Assume that the 2nd carbon atom of pyruvate is labeled with C14 and then the labeled pyruvate is…
A: Recall that during glycolysis, glucose is converted to pyruvate. Pyruvate enters TCA as acetyl CoA…
Q: IFs, provide very little mechanical strength to cells. How can you rebut this and provide…
A: Intermediate filaments are the cytoskeleton which provide the mechanical support and maintenance the…
Q: Compounds that are totally non-polar is described as Amphoteric Hydrophobic…
A: Fatty acids are the simplest type of lipid. They are carboxylic acids with hydrocarbon chain. They…
Q: pepsin require the High PHO low DH
A: Digestion is a metabolic process through which large molecules are broken down into small molecules…
Q: Under anaerobic conditions, pyruvate will be converted to lactic acid. Why does this occur? To…
A: Anaerobic Glycolysis is the catabolic process during which Glucose is broken down into lactic acid…
Q: НО НОН Н- Но Н ОН ОН H ОН НОН Но на но но н ОН ОН H H
A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the glycosidic…
Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…
A: Cancer means uncontrolled cell division. There are several therapeutic agents are used to treat…
Q: 4. Identify which of the following amino acid residues can have hydrogen bonding between their side…
A: The structure of the protein is stabilized by the different types of bonds (covalent and…
Q: he Michaelis-Menten rate equation for reversible mixed inhibition is written as Vo max [S] akm + a'…
A: Michaelis-Menten equation represents enzyme-catalyzed reactions with a single substrate. Based on…
Q: Folding is: formation of the primary structure of the protein phosphorylation of serine residues. in…
A: The most prevalent organic molecule in a living system is a protein. They can be found throughout…
Q: Fact Check Match the following statements about protein struc- ture with the proper levels of…
A: A-2 Primary structure - The order of amino acid residues in the polypeptide chain - encompassed the…
Q: INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS…
A: Guanine is a nitrogenous base and is a purine. When linked to a pentose sugar, it is called a…
Q: Glucagon increases hepatic gluconeogenesis by decreasing the cytosolic concentration of which of the…
A: The hormone glucagon sends signals to the liver to produce more glucose and its release when the…
Q: Do carbohydrates increase insulin resistance
A: Insulin is an hormone secreted by the Beta cells of the pancreas. Insulin reduces the blood glucose…
Q: 10. Escherichia coli is a bacteria that can cause food poisoning if people eat contaminated food or…
A: Initial count of bacteria = 50 Final Count of bacteria = 100000 Tripling time = 1 Hour
Q: Based in your learning in this course, from what process was the siRNA cell protection mechanism…
A: As per the literature so far, there are many theories suggesting the evolution of siRNA cell…
Q: Calculate the number of ATPs generated by completely oxidizing one molecule of tripalmitoylglycerol…
A: Tripalmitoylglycerol will be converted to three molecules of palmitic acid and one molecule of…
Q: effect of the temperature and ph on amylase temperature What is the purpose and objective of this…
A: Temperature and pH affect the metabolic activity of the enzymes.
Q: antibiotics that bind to 30S ribosomal subunit trimetjoprime chloramphenicol sulfonamide…
A: Antibiotics affect the growth of bacteria by inhibiting various metabolic pathways, replication,…
Q: H CH2OH ОН A CH₂OH B C Но E CH₂OH
A: Anomeric carbon is the carbon which bears a hemiacetal or acetal or hemiketal or ketal. In the…
Q: Describe the importance of Wee1, Myt1, CAK and cdc25 activity on the activation of the cyclin B/CDK1…
A: CDKs are the proteins whose concentration increases or decreases during the cell cycle. The…
Q: Name and in a brief describe the process by which immunological diversity is generated.
A: The ability of multicellular creatures to withstand dangerous germs is referred to as immunity.…
Q: 7. Compare and contrast negative feedback and positive feedback. Give an example of each. O
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Statement Analysis: Statement 1: The first law of thermodynamics states that the amount of energy in…
A: We will discuss both the statements and check if they are true or false.
Q: What are other substances/situations that can cause protein precipitation?
A: Introduction: Proteins are nitrogenous macromolecules that are the polymers of amino acids. It…
Q: Immunostaining was used to investigate the expression of the Fibrillin 1 gene in muscle fibres. Two…
A: Immunostaining is a process of staining proteins by antibodies that are covalently linked to an…
Q: full oxidation of 2 moles of glucos cose produce 36ATP O
A: Overall ATP production for glucose oxidation : C6H12O6 + 6CO2 + ADP +Pi -----> 6CO2 + 6H2O +ATP
Q: List at least two (2) importance/applications of systematic separation of cations into groups in…
A: Cations are very crucial for the body and hence, their proper detection and identifying their…
Q: Question 13 of 13 DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG…
A: DNA has two antiparallel strands of which one runs in 5'-3' direction and other in 3'-5' direction.…
Q: Q/What metabolic defect causes galactosemia? and what is lactose intolerance ?
A: Lactose is a disaccharide that is composed of monomers of glucose & galactose connected by β 1…
Q: Choose the FALSE statement about protein electrophoresis. The proteins in the gel can be…
A: Electrophoresis is a process in which electric field is applied to separate macromolecules like…
Q: In the phase- II molabaliem given some options below in which Choose the accid who not participant…
A: Introduction: Drug metabolism refers to the enzyme-mediated biotransformation that modifies the…
Q: INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS…
A: RNA is called ribonucleic acid. RNA has several different forms based on their function and these…
Step by step
Solved in 2 steps
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'Identify the primary sequence for the polypeptide that yields these fragments upon treatment: His-met-thr-met-ala-trp; Leu-asn-asp-phe; Val-lys obtained from chymotrypsin Leu-asn-asp-phe-his-met; Ala-trp-val-lys; Thr-met obtained from CNBRIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
- 6. Given: 3"--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is the sequence of amino acids in the protein coded by the MRNA? c) If the first G is substituted by A, what is the sequence of amino acids in the protein? d) What type of mutation is illustrated by (e)?5'....TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAA actgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?a) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.
- Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preservedThe genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?5'......TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAAactgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?
- Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were as follows: Trp-Arg-Thr-Gin Ser-Trp-Arg-His-Trp-Ala-Lys Asp-Val-Ala-Ala-Lys Asn-Ser-Asn-Val-Ile-Arg The sequences of the smaller peptides produced by chymotrypsin digestion were as follows: Arg-His-Trp Arg-Thr-Gin Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp The original peptide sequence was: Asp-Val-Ala-Ala-Lys-Ser-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-His-Trp-Arg-Thr-Gin Asp-Val-Ala-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin-Ser-Trp-Arg-His-Trp-Ala-Lys Trp-Arg-Thr-Gin-Asn-Ser-Asn-Val-Ile-Arg-Ser-Trp-Arg-His-Trp-Ala-Lys-Asp-Val-Ala-Ala-Lys Arg-His-Trp-Arg-Thr-Gln-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Asp-Val-Ala-Ala-Lys-Ser-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp-Arg-His-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin…With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?