Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preserved

Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preserved

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid sequence of the translated peptide? Rather than using abbreviations, write out the entire name of each of the amino acids in your peptide, so you do not risk using the wrong abbreviation and, therefore, providing the wrong sequence. 5' - ATG CTT GTA ATA CCG TGA - 3'
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
a) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.
Breast cancer can be caused by a genetic mutation on the BRCA1 gene changing a methionine to an arginine residue in the transcribed protein. How will this mutation effect this protein? a) Polarity before and after mutation: b) Size of the region before and after the mutation: c) Tertiary interaction you would expect with substrate: d) Name an amino acid that the unaffected protein's methionine could interact:
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-Arg
If the following truncated peptide represents the active domain of the COVID19’s S-protein N-terminal ----Leu-Leu-Gly-Cys-Ile-Glu-Ser-Thr-Cys-Ala ------ C-terminal a) state the RNA sequence of this peptide given that Leu is the first amino acid b) show a point mutation using the RNA sequence & explain how it results in silent mutation effect c) show a deletion mutation using the RNA sequence & explain the consequence(s)
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein sequences (N-C terminus) using the single letter abbreviations for each 5' GCA UAU CCU UGU GAU 3' B) Identify the two unique amino acids in the protein sequence above, provide their full names and brief explanation why you chose them C) Draw the two amino acids from 3. connected with a peptide bond to each other (with free amino and carboxy termini) at physiological pH|