Folding is: formation of the primary structure of the protein phosphorylation of serine residues. in the peptide chain formation of a supramolecular structure formation of protein tertiary structure
Q: What constitutes the backbone of a nucleic acid?
A: Introduction: A nucleic acid is a biological large molecule composed of nucleotide chains. These…
Q: Which of the following carbohydrates function as a major source of cellular fuel? a. starch in plant…
A: Introduction: Carbohydrates are large biomolecules that are present abundantly on the earth. It…
Q: What would the tertiary structure of Pro-ala and Glycl-L-alanine be?
A: Proteins are polymers of amino acids linked by peptide/amide bonds between the carboxyl group of one…
Q: 3. What will the flow rate be in milliliters per hour for vancomycin 1g/500 mL IV, if it is to be…
A: Given Values: Total IV = 1g /500 ml Total time for infusion = 90 minutes
Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…
A: DNA is a hereditary material that is made up of adenine Guanine Cytosine and Thymine. As it is a…
Q: The following has the lowest energy per gram when oxidized Carbohydrate protein O ethanol O Lipids O
A: Nutrients are the compounds that provide us energy when they are oxidised. These nutrients like…
Q: write true if the statement if correct and change the " " word/phrase to make it correct in the…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Compare the process of facilitated diffusion to the process of osmosis.
A: The cell membrane is a living, crucial part of the cell. It acts as a physical barrier, enclosing…
Q: What secondary structural elements are most likely present in this sequence? Please annotate the…
A: Proteins are polymers of amino acids linked by peptide/amide bonds between the carboxyl group of one…
Q: A biochemist is trying to determine the type of proteases they have isolated from walrus blubber.…
A: The modification of amino acid side chains using amino acid specific covalent labeling is an…
Q: QUESTION 34 After40 minutes of sun exposure, which of the following people will produce the most…
A: Vitamins are important for cellular functions such as cell reproduction, growth, and energy…
Q: What is the condition associated with a deficiency on enzyme phenylalanine hydroxylase? albinism…
A: Enzymes are the catalysts that carry out biochemical reactions. These are proteins in nature.…
Q: What is the relation between GMO crops and the four of the principles of bioethics? What issues are…
A: A GMO, or genetically modified organism, whose genetic makeup has been modified using scientific…
Q: Lactate dehydrogenase (LDH) plays an essential role in an exercising muscle, especially when the…
A: During cellular respiration, respiratory substrates like glucose may undergo complete or…
Q: In the Watson-Crick structure of DNA, the: a. adenine content of one strand must equal the thymine…
A: Watson and Crick model of DNA has two strands that wound around each other and form double hellicle…
Q: Explain why vegetable oil and water don't dissolve in one another.
A: Lipids are non-polar biomolecules composed of fatty acids and an alcohol. Some of the lipids have…
Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…
A: The classical method of lipid extraction from egg yolk is the 2-Propanol/Hexane solvent extraction…
Q: Describe/Explain each of the following: 1. Salivary Digestion 2. Gastric Digestion 3. Intestinal…
A: Digestion is a process of breakdown of big food pieces into small pieces with that help of teeth and…
Q: Calculate Kd for the binding of each ligand to this protein. Which ligand binds with greatest…
A: The affinity between the protein and ligand can be studied by association and dissociation kinetics.…
Q: TWIKKUNJUN Bacampicillin is a pro-drug of ampicillin. Esterases take function in its conversion.…
A: Bacampicillin is a pro-drug of ampicillin. Esterases take function in its conversion. Beside the…
Q: Give a precise definition of the porphyrin ring, explain how it relates to ions and molecules, and…
A: Porphyrins are a class of heterocyclic macrocycle organic compounds made up of four modified pyrrole…
Q: Which of the following type of metabolites is used for generating glucose under severe starvation…
A: Metabolism : It is process of breakdown (catabolism) and synthesis (anabolism) of biomolecules in…
Q: Explain the fate of amino acids
A: Digestion of dietary proteins and degradation of cellular proteins generates free amino acids. They…
Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…
A: Agarose gel electrophoresis is a method of gel electrophoresis that is used to separate a mixed…
Q: Statement Analysis: Statement 1: In glycolysis, a molecule of glucose is degraded in a series of…
A: Glycolysis is the catabolic pathway in which Glucose is broken down to energy in the form of ATP.
Q: The diagram below shows the substrate binding cleft for a protease, providing the substrate…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: You apply a new drug to a different batch of neurons and record membrane potential changes in the…
A: Permeability barrier and semi permeability of cell membrane are both maintained by lipids. only…
Q: QUESTION 40 All of the following are health risks associated with obesity, EXCEPT: O A. hypertension…
A: Correct option - B. sleep apnea - Hypertension, osteoporosis, type 2 diabetes are all risk factors…
Q: Consider the metabolic pathway show below that converts substrate A to B with the enzyme A-ase, B to…
A: For regulation of A-ase: Feedback inhibition refers to the inhibition of the enzymes's activity by…
Q: write true if the statement if correct and change the bold word/phrase to make it correct addition…
A: Hydrolysis of glycogen is done by the enzyme Glycogen phosphorylase. The activity of this enzyme is…
Q: A protein was recently discovered to be located in the nucleus. However, it is uncertain whether…
A: The most important and basic knowledge that we should remember here in-order to understand the…
Q: What would the tertiary structure of the dipeptide Asp-Ser be if it was made into a polypeptide…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: What is the difference between -OH and OH-?
A: Introduction: The term hydroxide ion refers to OH group-containing negative charge present in…
Q: Serum concentrations of acetoacetate and ß-hydroxybutyrate increase dramatically after a 3-day fast…
A: Acetone, acetoacetate, and beta-hydroxybutyrate are called ketone bodies. Ketone bodies are…
Q: What relates to post-transcriptional modifications Polyadenylation Phosphorylation Acetylation…
A: Post-transcriptional modification modification is a set of biological processes that occurs in…
Q: Hi! Can you give an explanation for each sample identity in paragraph form (for the rationale)?…
A: Introduction: Carbohydrates are large macromolecules that contain three essential elements which are…
Q: Mach the terms left with as many terms GMP Nucleotide at right by entering @ Nucleoside 3 Z-DNA…
A: Thank you for your question, Here is the answers for the above match the following with…
Q: Neurotransmitter Glutamate GABA Acetylcholine (Ach) Dopamine General Function (a few words) Primary…
A: A neurotransmitter is a signaling molecule secreted by a neuron to affect another cell across a…
Q: To prepare 500 mL of a 1X TAE buffer solution, we need to mix solution (so 25 times more…
A: TAE is a standard buffer for the preparation and operation of DNA agarose gels. TBE provides…
Q: Peptide 1: Peptide 2: NH₂ H₂N pro-ile-glu-arg N OH OH OH OH
A:
Q: 1- Why is CO2 often used in an incubator to culture mammalian cells? O to control or prevent…
A: CO2 incubators are climatically controlled, airtight containers used in life science labs to…
Q: For question 19, create a diagram for the P generation (parent generation) and F1 generation (first…
A: Purebreds are the individual with homozygous combination of alleles. Alleles are the alternative…
Q: For this assignment I Then I have to explain these questions and I have been confused because I…
A: Since you have asked multiple question, we will solve the first three questions for you. If you want…
Q: write true if the statement if correct and change the " " word/phrase to make it correct…
A: Chromatography is biochemical separation method for organic molecules or solutes of a compound…
Q: Which out of the following statements is true about the regulation of metabolic pathway? a) Most of…
A: The metabolic pathway involves a series of interconnected chemical reactions occurring in the cell.…
Q: 10. Certain molecules in the muscular system must be maintained in a homeostatic range for the…
A: Muscular system maintains homeostasis by movement, support and heat production. There are certain…
Q: Chemistry help with c, d, e, and i.
A: In the citric acid cycle, the acetyl group of acetyl CoA molecule is completely oxidized. The citric…
Q: Which statement is TRUE regarding the glycolytic pathway? a. It includes five phosphate transfer…
A: The metabolic process known as glycolysis is where organisms obtain ATP energy from the breakdown of…
Q: In order to sediment mitochondria, you were asked to centrifuge at an RPM of 5600 to give an RCF of…
A: The relative centrifugal force (RCF) is the radial force that is generated in a spinning rotor that…
Q: In RNA OH group is present at 2' position True O
A: Nucleic acid is made up of nucleotides, when number of nucleotides are joined together then the…
Step by step
Solved in 4 steps
- Question one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the MRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar). B (Ctrl) -Question 15 Activities found in the rough ER and its functions include the folllowing EXCEPT provides a membrane binding site for the RNA with signal a signal sequence facilitates post-translational modifications allows the entry of polypeptides that will undergo glycosylation provides a membrane scaffold for binding of ribosomes for protein synthesisQUESTION 13 Match the primary sequence to its characteristics/function/fate N-signal signal-anchor stop-anchor nuclear localization sequence KDEL 1. found at carboxyl terminus of ER resident proteins, interaction with its receptor directs retrieval from Golgi 2. hydrophobic, interacts with SRP and translocon, becomes transmembrane helix 3. mostly hydrophobic, interacts with SRP, cut off 4. hydrophobic, interacts with translocon, becomes transmembrane helix 5. basic, interacts with importin-alpha
- Question 19 Based on the hydropathic index plot below, where in the 3D structure of the protein would you expect to find amino acid number 185? 40 Hydrophobic 20 -20 -40 Hydrophilic 40 60 80 100 120 140 160 180 200 220 240 Residue number Alpha helix Beta sheet O Double helix O Quaternary contact O Interior of the protein O Surface of the protein Hydropathic index 20Question 12 In the tertiary structure of a protein, the R-group of valine can interact with the R-group of via a _ O leucine; hydrophobic interaction O lysine, electrostatic interaction O threonine, hydrogen bond alanine; hydrogen bondQUESTION 12 Baker's de novo protein design involves which of the following: a. Use currently synthesized and natural amino acids to design a protein with a specific function b. Design new amino acids that can be used for the specific protein functions of interest c. Work from a desired function to an appropriate structure to a suitable amino acid sequence O d. Work from an amino acid sequence to the correct 3-D folding to the desired function
- Question 5 The core protein of a proteoglycan is noncovalently attached to: O oligosaccharides. glycosaminoglycans O keratin sulfate. O hyaluronic acid backboneQuestion 11 Given this MRNA strand: 3' - AUGAGGAAGGUA - 5'; what are the components of the polypeptide? First Position Third Position (3' end) (5' end) U A G UGU Cys UUU Phe UUC Phe UCU Ser UCC Ser UCA Ser UAU Tyr UAC Tyr UAA Stop UAG Stop |U UGC Cys UUA Leu UUG Leu UGA Stop |A UGG Trp U G CGU Arg CGC Arg CGA Arg UCG Ser CAU His САС His CAA Gln CAG Gln CUU Leu CCU Pro U ССС Pro CỤC Leu CỦA Leu CUG Leu CCA Pro A CCG Pro CGG Arg G U AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu AUU Ile ACU Thr АСС Thr ACA Thr ACG Thr AGU Ser AUC Ile A AUA Ile AGC Ser AGA Arg A AUG Met* AGG Arg G GUU Val GGU Gly GCU Ala GCC Ala GCA Ala GCG Ala U GGC Gly GÚC Val G GUA Val GGA Gly |A GUG Val GGG Gly GQUESTION 25 Phosphorylation, acetylation, methylation, and ubiquitylation are all ways to: Regulate carbohydrates using small molecules O Turn on and off the activity of proteins O Remove amino acids from proteins O Join proteins together
- QUESTION 20 Trypsin digestion of the peptide sequence A2-P2-M3-E4-R5-G6-F7-Hg-Ag-I10-A11-H12-T13-Y14-G15-P16 results peptide fragment(s). in To elute the His-tag protein from the nickel agarose column, the elution buffer contains a high concentration of Chymotrypsin cleaves the N-terminus side of Phe, Tyr, and Trp. True O FalseQuestion 11 To correctly perform and interpret a proteomic analysis, careful attention of which of the following may be needed proteins' compositions can be influenced by pH, hypoxia, drug treatment, or other environments, which may influence the outcome of an experiment the myriad ways proteins can be processed and modified the large range of protein abundances observed spanning 6 to 10 orders of magnitude in eukaryotes selecting among the numerous PCR protocols for amplifying the naturally observed proteinsQUESTION 11 If the DNA gene is TAC GGT TTA CAG, which amino acids will be put together? O A. methionine-proline-aspargine-valine O B. tyrosine-glycine-leucine-glutamine OC valine-serine-threonine-lysine O D. phenylalanine-cysteine-tryptophan-alanine