6. Given: 3"--TACTTCAAACCGGGCCCGATT--5a) Give the sequence of nucleotides in the mRNA.b) What is the sequence of amino acids in the protein coded by the MRNA?c) If the first G is substituted by A, what is the sequence of amino acids in the protein?d) What type of mutation is illustrated by (e)?

The DNA is translated into mRNA by transcription process and then the mRNA is translated into…

Answered: 6. Given: 3--TACTTCAAACCGGGCCCGATT--5…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5" A.) What is the MRNA sequence that would result from transcription of this sequence? Assume that the DNA would be read from left to right. What is the amino acid sequence that would result from translation of B.) the MRNA resulting from the sequence? See Codon Table on next page. 20 C.) What is the anti-codon found on the tRNA that would deliver the amino acid for the first codon in the MRNA sequence? D.) If the fourth nucleotide in the DNA sequence were deleted due to a mutation during DNA replication, what would the resulting amino acid sequence be? What type of mutation is this? E.) What impact would the mutation in the DNA sequence in PART D have on the function of the protein produced from original sequence? Why?
CH3 D) H,N-CH-c-o CH, CH-CH3 13. A silent mutation does not change the protein that is produced. B) has a very minor change on the protein produced (ie, Glu to Asp). C) has a major change on the protein produced (ie, Glu to Val) causes protein synthesis to stop due to a stop codon. A) D) 14. Which amino acid sequence is coded for from DNA with the coding strand sequence 5' AAG GCT AGT GGC 3'? A) Thr-His-Asn-Asp Gly-Ser-Ala-Lys B) Lys-Ala-Ser-Gly C) Asp-Asn-His–Thr D)
2. In the cytoplasm of the cell below, four tRNA molecules are carrying amino acids. a) What amino acids are being carried or transferred? (Careful of anticodons!) b) Where would the tRNA be taking the amino acids? c) Label where necessary. ACG ACC a.a. u uu a.a 45 luc m) IV)
1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the functional mRNA? b.) what is the sequence of the 25th codon? c.) what is the sequence of the stop codon? 2. If the mRNA transcribed for this gene will be translated into a functional protein, a.) how many amino acids will be used to build the polypeptide chain? b.) what is the amino acid coded by the 25th codon? c.) what is the amino acid coded by the last codon? 3. If the above gene is one of the three structural genes of the lac operon that codes for the protein/ enzyme responsible for breaking lactose into two molecules of simple sugars, a.) what triggers the activation of this gene? b.) what triggers the inactivation of this gene? c.) what substance is attached to the operator region of the operon in the absence of activator? d.) what gene is responsible for the synthesis of the substance used to attach in the operator region in the absence of activator? e.) what…
1. If the gene above is transcribed into a functional mRNA,a.) how many codons will be carried by the functional mRNA?b.) what is the sequence of the 25th codon?c.) what is the sequence of the stop codon?2. If the mRNA transcribed for this gene will be translated into a functional protein,a.) how many amino acids will be used to build the polypeptide chain?b.) what is the amino acid coded by the 25th codon?c.) what is the amino acid coded by the last codon?
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?
4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide the amino acids specified by the mini mRNA. b) Label the two ends of the short peptide.
A mini mRNA has the sequence 5'UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3'. a) Use the genetic code to provide the amino acids specified by the mRNA. b) Label the two ends of the short peptide.
The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence b) State the amino acid sequence of the polypeptide translated from this mRNA c) Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein associated with this DNA template strand? Give the sequence of amino acids encoded by this fragment. Leave traces of your steps. B) In the synthesis of this protein, what are the codon and the anticodon for? Explain in one sentence for each. C) We find, in another cell, a mutation of this DNA template strand: 3' ATA GCG TGG AGT ATC-5’ 1. What type of point mutation is it? 2. Did this mutation arise during transcription, translation or DNA replication? D) If this mutation is found in a spermatozoon, will it have an effect on the individual, its offspring or both? Briefly explain

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS

6. Given: 3--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is the sequence of amino acids in the protein coded by the MRNA? c) If the first G is substituted by A, what is the sequence of amino acids in the protein? d) What type of mutation is illustrated by (c)?