Given below is the mRNA sequence that encodes the amino acids of a protein. Based on the mRNA sequence predict the amino acid sequence that it encodes. Please list the protein sequence as SINGLE letter amino acids. mRNA: -AUGACACCACUCCACUUAUAGCCCUAA-
Q: complete steps of haworth projection of D-tagatose
A: If the OH of the bottom most chiral center of the fisher projection of a monosaccharide is placed…
Q: M-CSA Mechanism and Catalytic Site Atlas (ebi.ac.uk) (ii) Acyl Carrier Protein S-acetyltransferase…
A: The FASN gene in humans codes for the enzyme fatty acid synthase (FAS). The multienzyme protein…
Q: Which statement accurately describes structure A in the figure above? B. H A. Н c=0 H-C-OH НО-C-H…
A: D and L designations of sugars are given on the basis of position of the hydroxyl group on the…
Q: pyruvate dehydrogenase complex a-ketoglutarate dehydrogenase Pyruvate + succinate dehydrogenase…
A: Respiration is an essential process that occurs in all living beings in which oxygen is utilised and…
Q: Choose False during an enzyme catalyzed reaction. Substrate concentration is typically much larger…
A: Enzyme kinetics is the field of biochemistry concerned with quantitative measurement of the rates of…
Q: Use the scoring system described to calculate the alignment score for IPNIA A IG D V VAG P VKGIYA V…
A: The alignment score is the sum of individual matches when two or more DNA or protein sequences are…
Q: 1. Jenny and Joe are heterozygous for green eyes which is recessive. They have 5 children. What is…
A: The objective of this question is to calculate the probability of Jenny and Joe's children having…
Q: (1) Identify the chiral atoms, if any, with an asterisk (") in the following compounds. CH OH CH OH…
A: Monosaccharides are simple sugars that form the building blocks of carbohydrates. They are…
Q: Genetics Question 1
A: The objective of the question is to determine the possible inheritance patterns of a trait based on…
Q: Genetics Question 3
A: The objective of the question is to understand the inheritance pattern of an X-linked recessive…
Q: Structures PLEASE DRAW OUT THE FATTY ACIDS - Hydrocarbon chain atoms DO NOT need to be labeled,…
A: A fatty acid is a carboxylic acid with an aliphatic chain. These chains are either saturated or…
Q: True or False: The presence of Howell-Jolly bodies on a blood smear is indicative of asplenia or…
A: Howell-Jolly bodies are clusters of DNA which are nothing but basophilic nuclear remenents present…
Q: total, including lactose, how many heterodisaccharides of D-galactose and O-glucose are possible?
A: D- glucose is also considered as D-glucopyranose and D-galactose is also considered as…
Q: When the product of reaction \\( A \\) becomes the reactant of reaction \\( B \\), the metabolic…
A: Metabolism is the sum of all the chemical changes (anabolism and catabolism) occurring in the cell.…
Q: Draw a Haworth projection of a common cyclic form of this monosaccharide: Н. H н- I НО НО -OH - ОН…
A: Haworth projection is an improvement of cyclic Fischer projection. This represents 3D perspective of…
Q: 4. Using a fluorescent model substrate, you study the kinetics of an enzyme-catalyzed reaction. You…
A: Enzymes are the biocatalysts that catalyse the biochemical reactions by lowering the activation…
Q: Question 1: a) Below is the structure of raffinose, a main component of molasses. The trisaccharide…
A: There are four classes of biological macromolecules: nucleic acids, proteins, lipids and…
Q: What ultimately powers the synthesis of ATP in cells? Group of answer choices Electrochemical…
A: The question is asking about the ultimate source of energy that powers the synthesis of ATP…
Q: Sketch out the titration curve below and the structure(s) of the major ionic form(s) of glutamic…
A: Amino Acids: Amino acids are organic composites that serve as the abecedarian structure blocks of…
Q: a) НО b) 1) Name each listed compound (a, b, c, d) below, 2) Arrange them in a right reaction order…
A: The given compounds are from the reaction of glucuronidation.Compound structural names as given…
Q: Aminotransferases (transaminases) amino acid during transamination
A: PLP (pyridoxal phosphate):It is the active form of vitamin B6 i.e., a water-soluble vitamin which is…
Q: 7). You analyze a biosynthetic pathway in an unknown strain of bacteria. Given the following data…
A: 3-phosphoglycerate (PGA) is used by bacteria as the starting material to synthesize serine. From…
Q: Lipids _____ 1. Cephalin vs. Cholesterol _____ 2. Palmitic acid vs. Cerebroside _____ 3.…
A: The objective of the question is to understand the differences between various types of lipids and…
Q: 32) You are working with an molecule with a pl of 6.00 and the pka's of the ionizable groups on the…
A: ● If the pKa is lower than the pH the molecule will be deprotonated i.e it will carry negative…
Q: Question 5 Listen Paul, has hemophilia, a sex linked recessive condition. Which of the following is…
A: The objective of the question is to determine the correct genotype for Paul who has hemophilia, a…
Q: Which of the following metal complexes are responsible for the reduction of molecular oxygen? Group…
A: The question is asking us to identify which metal complex is responsible for the reduction of…
Q: HENRY is a peptide sequence. 1) Draw the structure of the HENRY peptide as it exists at pH 7. Be…
A: Peptides are composed of amino acids joined to each other via peptide bonds. Peptides can have one…
Q: Which of the following best describes the sequence variation within class | MHC molecules? A)…
A: MHC stands for Major Histocompatibility Complex molecules. They are a type of cell surface proteins.…
Q: Imagine the main chain of a protein bends back on itself, so that two amino acid residues R, and R,…
A: Salt bridge is a bond between amino acids which carry opposite charges. The opposite charges exert…
Q: What are the biological actions of enzymes ? What reactions do they catalyze? please include…
A: 1. Overview of Enzymes: Since they catalyze chemical reactions in living things without being…
Q: Using the catalytic mechanism of serine proteases, draw and label a reaction coordinate…
A: In order to draw the reaction coordinate diagram of the chymotrypsin catalyzed hydrolysis of a…
Q: Which of the following is true of the difference between Class I and Class II B-lactamase…
A: Beta lactamase inhibitors are the substances or compounds that inhibit beta lactamase enzymes. Beta…
Q: Genetics Question 8
A: The objective of the question is to determine whether the given statement about expressivity in…
Q: provide an example of internal myopia, external myopia, and normative myopia in health care,…
A: Myopia is an eye condition where light from far-off objects focuses in front of the retina rather…
Q: Classify each molecule as polar or nonpolar. :Br :Br: C :Br: Polar :4: * :F: Answer Bank :CI: H-C H…
A: The polar or nonpolar characteristics of a molecule depend on two factors: the difference in…
Q: which yields more free energy when completely oxidized, stearate or alpha-linolenate?
A: The objective of this question is to determine which molecule, stearate or alpha-linolenate, yields…
Q: Explain the following observation: At a pH of 7:0, polylysine, which is a peptide in which all…
A: Proteins are biological macromolecules that are composed of twenty naturally occurring amino acids…
Q: Why does the reaction proceed readily as written under physiological conditions? The reaction is…
A: gives the change in Gibbs free energy under standard conditions. The conditions prevalent inside…
Q: how is sfGFP different than the wildtype GFP found in jellyfish
A: The question is asking about the differences between sfGFP (superfolder Green Fluorescent Protein)…
Q: Determine the fraction of Vmax that would be obtained when the substrate concentration, [S], is…
A: Michaelis-Menten equation:Leonor Michaelis and Maude Menten created a simple model that accounts for…
Q: What is the purpose of adding hydroquinone? What is the purpose of washing the egg homogenate with…
A: Since you have posted multiple questions, we will provide solution only to the the first question…
Q: Which of the twenty naturally occurring amino acid side chains are charged at a pan of 1.00? pH of…
A: Amino acids can be defined as organic compounds which comprise of both amino & carboxylic acid…
Q: Dihybrid Cross Problem 7: Homozygous offspring of a dihybrid cross. In a dihybrid cross, AaBb x…
A: The objective of this question is to determine the fraction of offspring that will be homozygous for…
Q: Carbohydrates differ in solubility based on the size of the molecule. Which of the following…
A: Carbohydrates are the biomolecules which are classified into monosacharides, oligosaccharides and…
Q: Polar and neutral HO H OOC-CH₂-CH₂-C-COO NH3 NH3 CH₂-CH-C-0 0=0 Nonpolar hydrophobic amino acids Met…
A: Amino acids are biomolecules in which an alpha-carbon is bonded to 4 groups. The 4 groups are;a…
Q: why does A2-B3 structure is active (contain the antibiotic) and the (A2-…
A: Aldehydes and ketones react with hydrazine to form hydrazones which is a part of Wolff-Kishner…
Q: What is the approximate pl of the peptide "HYTCD"? 04.5 7.00
A: Peptide have difference in the charge based on the ionizable groups present. The peptide have 4…
Q: Predict the missing reactant of this biochemical reaction: X + Pi CH3 CH2−O fo O + H₂O That is, in…
A: Phosphorylation is a chemical reaction in which phosphate group is added to a reactant molecule.The…
Q: Suppose you have a crude sample of compound X and you attempt to purify it by recrystallization with…
A: Recrystallization is defined as a purification technique which is commonly used in chemistry to…
Q: Monosaccharides have the general molecular formula of (CH₂0)m, where m is the number carbons. (m=5…
A: Starch is formed as a result of polymerization of glucose. This is also a condensation reaction as a…
Given below is the mRNA sequence that encodes the amino acids of a protein.
Based on the mRNA sequence predict the amino acid sequence that it encodes. Please list the
protein sequence as SINGLE letter amino acids.
mRNA: -AUGACACCACUCCACUUAUAGCCCUAA-
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 1 images
- The line below represents a mature eukaryotic mRNA. The accompanying list contains many sequences or structures that may or may not be a part of mature eukaryotic mRNA. As accurately as you can, show the location, on the line, of the sequences or structures that belong on the eukaryotic mRNA; then separately list the items that are not part of eukaryotic mature mRNA. 5’____________________________________________________3’ A-stop codon B-poly-A tail C- intron D- 3’UTR E-promoter F- start codon G- AAUAAA H- 5’ UTR I- 5’ cap J- Termination sequenceHere is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that would be transcribed from the bottom strand of the DNA:If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTY
- Using the genetic code, translate your mRNA sequence of 60 nucleotides into a polypeptide. Use one-letter abbreviations for the amino acids. Enter one-letter abbreviations corresponding to the amino acids.In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Note, the answer blanks for mRNA may appear vertically on some displays. In this case, enter the bases from top to bottom. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. Enter the full, unabbreviated name of the amino acid in the blank provided. In the case of a stop codon, enter "Stop"In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. DNA T-A-C A-A-G A-T-G G-G-G A-T-T mRNA Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Amino acid Enter Text Enter Text Enter Text Enter Text Enter Text
- Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- Give the protein synthesized of the given mRNA sequence. No need to explain. Just give the answer. ACUGAAAUGACCAGAUUUAUGGCCUGAAUGACCBelow is an MRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz are numbered as shown. Answer questions 1-4 for the mRNA of Lstqz. A codon table with amino acids shown in single-letter code has been provided at this link. 1 5 10 15 20 25 30 35 40 5' AGAGAUGGCUCCUUCACGCUUUACCUACUGAGUAGGGCUAAG 3’ Which nucleotide number corresponds to the first nucleotide of the stop codon? (Please answer as a numeric value) 30 Write down the first five amino acids generated from this mRNA in single-letter designation with no spaces. Example: if the answer is (from N to C terminus) Histidine-Threonine-Glutamate, you would put in HTE (uppercase) as the answer.draw mRNA sequence for the following sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG