Which of the following is the correct sequence for RNA splicing: 1. U2 binds to the branch site and ATP is hydrolyzed 2. U1 binds to the GU sequence at 5’ splice 3. U5/U4/U6 trimer binds 4. U2/U5/U6 are bound to lariat and 3’ site is cleaved and exons are ligated using ATP hydrolysis. 5. U1 is release, U5 shifts from exon to intron and U6 binds at the 5’ splice site 6. U4 is released, U6/U2 catalyzes transesterification, U5 binds exon at 3’ splice site, and the5’ site is cleaved. Group of answer choices 4,3,1,2,6,5 5,4,2,3,6,1 3,1,4,2,5,6 1,2,3,4,5,6 2,1,3,5,6,4

Which of the following is the correct sequence for RNA splicing: 1. U2 binds to the branch site and ATP is hydrolyzed 2. U1 binds to the GU sequence at 5’ splice 3. U5/U4/U6 trimer binds 4. U2/U5/U6 are bound to lariat and 3’ site is cleaved and exons are ligated using ATP hydrolysis. 5. U1 is release, U5 shifts from exon to intron and U6 binds at the 5’ splice site 6. U4 is released, U6/U2 catalyzes transesterification, U5 binds exon at 3’ splice site, and the5’ site is cleaved. Group of answer choices 4,3,1,2,6,5 5,4,2,3,6,1 3,1,4,2,5,6 1,2,3,4,5,6 2,1,3,5,6,4

Name: Which of the following is the correct sequence for RNA splicing:1. U2
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following is the correct sequence for RNA splicing:1. U2 binds to the branch site and ATP is hydrolyzed2. U1 binds to the GU sequence at 5’ splice3. U5/U4/U6 trimer binds4. U2/U5/U6 are bound to lariat and 3’ site is cleaved and exons ar

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

Which of the following statements about the mechanism of splicing is correct? 1. A mutation in a 5' splice site will always lead to a shorter mRNA. 2. Mutations in a non-splice site (for example, middle of an intron) does not affect the protein. 3. snRNPs at a 5' splice site can recognize and bind to snRNPs at another 5' splice stie. It is possible that a mutation in a splice site can lead to the removal of an exon. 4. A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only O E. All of 1, 2, 3 and 4 are correct.
if the following DNA sequence were transcribed, which of the following describes the output of this process? 3'- TCTGGACA-5' A. This would produce a protein that looks like 5'- A G A C C U G U -3' B. This would produce a tRNA that looks like 3'- A G AC C U G U -5' C. This would produce an mRNA that looks like this: 5'- A G AC C U G U -3' D. This would produce an mRNA that looks like 3'- U C U G G A CA -5' E. This would produce another strand of DNA that 0ok like 5-AG ACCT GT-3. ..
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
The figure depicts what kind of splicing: A sequence change (asterisk) has abolished the acceptor site at the 3' end of intron 1. Exon 2 is skipped A sequence change has abolished the acceptor site at the normal end of intron 2. Instead of skipping exon 3, the spliceosome has found a nearby alternative acceptor-like sequence, a' in intron 2, to use. the three exons are spliced as processed normally A sequence change has activated a cryptic acceptor site, a’ in intron 2. A downstream sequence d' is used as a new donor site, creating a novel extra exon.
The tRNA anticodon sequence 3’GAG 5’ is charged with the amino acid leucine. This anticodon may pair with both 5’ CUC 3’ and 5’ CUU 3’. Which of the following is consistent with this phenomenon? 1. The information provided is not accurate since only the 5’ CUC 3’ codon can complementary base pair with the 3’ GAG 5’ anticodon 2. This feature allows for the genetic code to be degenerate 3. This feature allows for the genetic code to be overlapping 4. This feature is commonly associated with tautomeric shifts 5. This feature causes a change in the encoded amino acid
What happens if you replace the trp codons in the trp leader sequence with codons specifying Isoleucine? The cell will synthesize tryptophan when it is low on isoleucine The cell can't synthesize tryptophan at all The cell will synthesize Isoleucine when it is low on tryptophan O The cell will synthesize tryptophan when it is low on tryptophan
Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the TRNA anticodon 5' GCU 3', considering wobble-base pairing rules? UGA and CGA AGU and AGC CGA AGC O AGU, AGC, AGA, and AGG
The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!
Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
In the picture below (representing RNA transcription) match A-E to whether they are 5' or 3' ends. A 5' or 3"? s' or 3"? E в 5' or 3"? S' or 3"? D 5' or 3"? A [ Choose ] B [ Choose ] [ Choose ] D [Choose ] E [ Choose ] > > > >
Why would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA splicing? Spliced DNA could not be transcribed or translated DNA does not have a 3'-OH group for the initial nucleophilic attack that forms the lariat O DNA does not encode introns O DNA does not have a 2'-OH group for the initial nucleophilic attack that forms the lariat