The diagram shows part of a pre-mRNA molecule. A G part X (a) (i) Name the two substances that make up part X. (ii) Give the sequence of bases on the DNA strand from which this pre-mRNA has been transcribed. (b) (i) Give one way in which the structure of an MRNA molecule is different from the structure of a tRNA molecule. (ii) Explain the difference between pre-mRNA and mRNA. (c) The table shows the percentage of different bases in two pre-mRNA molecules. The molecules were transcribed from the DNA in different parts of a chromosome. Part of Percentage of base chromosome A G U Middle 38 20 24 End 31 22 26

Q: UAA is a stop codon. Why does the UAA sequence in the segment of mRNA…

A: Stop codons do not specify any amino acid. When ribosome faces any stop codon, it stalls. When the…

Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: Create an mRNA strand based on the given DNA template strand: TACTTCCTATTTTCTTGTCA CCGCACT Using the…

A: The process of synthesis of RNA with the help of DNA is called transcription and the process of…

Q: Match Column A with Column B. |Intron is removed from the MRNA transcript A 1st event v MRNA is…

A: Transcription is the mechanism by which mRNA is produced from template DNA in molecular biology. As…

Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…

A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…

Q: 22-69 Indicate whether each of the following statements relating to protein synthesis is true or…

A: The process in which the formation of proteins occurs is called protein synthesis. It is the main…

Q: the function of the small ribosomal subunits is

A:

Q: Describe the various post-transcriptional and post-translational modifications that occur during the…

A: Post-transcriptional modifications are those modifications that occur after the completion of…

Q: What is an Okazaki fragment, and how are they later “glued” together?

A: In the semi discontinuous mode of replication when DNA unwinds , one strand is synthesized…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: 1. If the gene above is transcribed into a functional mRNA,  a.) how many codons will be carried by…

A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…

Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…

A: DNA to mRNA is transcription and mRNA to protein is translation.

Q: An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of…

A: Anticodon is a sequence of three nucleotides on a tRNA molecule that bind to a specific…

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon  It is the three consecutive sequence of a mRNA that code for amino acid.

Q: How is the relationship between the tRNA and mRNA described

A: Messenger RNA is product of transcription process. A process where all the genetic information of…

Q: Give the initiation codon for protein synthesis. Name the amino acid it codes for?

A: A genetic codon is a three-nucleotide sequence of either DNA or RNA that corresponds to a particular…

Q: Name and explain the process by which mRNA is formed.

A: Gene expression is the process by which information which is contained in genes is decoded to…

Q: The sequence of bases in a sample of MRNA was found to be: GGU,AAU,CCU,UU0,GUU,ACU,CAU,UGU a Deduce…

A: mRNA is messenger RNA which is produced as a result of transcription from DNA. RNA polymerase…

Q: Sequence the following steps in protein synthesis from first to last (1-6) ___A. Transciptions…

A: TRANSLATION is the process by which a protein is synthesized from the information contained in a…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Describe  the relationship between

A: RNA is ribonucleic acid that is a single stranded nucleic acid composed of ribose sugar.  The mRNA…

Q: What is mRNA made of?

A: DNA and RNA are nucleic acids that are found in living cells. Almost all living cells contain both…

Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3     NH3+-…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Using seven numbered steps, describe the process of translation.

A: Translation : It is the process of translating the sequence of mRNA molecule to a sequence of amino…

Q: Diagram generally how a mRNA that contains sequences corresponding to four (4) exons would be…

A: In eukaryotes, genetic information is encoded in DNA is transcribed first as pre-mRNA strand. This…

Q: What is the role of ribosomes in protein synthesis? *   A. they carry proteins to the site of action…

A: Protein synthesis takes place in the cytoplasm. The mRNA is read in the pair of three bases at a…

Q: If a tRNA anticodon is CAA what is its corresponding mRNA codon? For the genetic code which amino…

A: Genes that provide instructions for proteins are expressed in a two-step process i.e., by…

Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…

A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…

Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…

A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…

Q: In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give…

A: 1 a) No, there wont be any problem in expressing the two genes. But in bacteria, most of the gene…

Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?

A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…

Q: What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?

A: The sequence of a protein is notated as a string of letters, according to the order of the amino…

Q: What would be the tRNA anticodons for the mRNA in question 3

A: Answer- ATGGATCT CGA- UACCUAGA GCT will be the following anti-codons .

Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…

A:

Q: Translate the RNA codons using the given genetic code  5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'

A: Translation:  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: Which statement is true of the translocation phase of elongation during protein synthesis?   a. The…

A: The translation is the process by which ribosome synthesis protein using mRNA. It consists of three…

Q: Translating mRNA C G A A U G C C G U A U U C G to amino acids

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.The…

Q: Why mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of…

A: Introduction  DNA and RNA are the main genetic material found in all the species irrespective of…

Q: If MRNA has the bases UAU, what is the matching tRNA? O UAU O ATA O TUT O AUA

A: DNA(deoxyribonucleic acid) is the genetic material in all organisms except few viruses. The genetic…

Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…

A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…

Q: What characteristic of the genetic code explains why a substitution mutation in a codon contained…

A: Codons are sets of three nucleotides responsible for the detection by tRNA for the type of amino…

Q: Which amino acid would be attached to a tRNA that read "GGU"?

A: Introduction :  A codon is defined as a sequence of three nucleotides which together form a unit of…

Q: Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence…

A: DNA is the genetic material that gets transcribed into mRNA by an RNA polymerase enzyme. The…

Q: Match each term with the most appropriate description. ​sites for polypeptide assembly   ​binds to…

A: All cells have the translation process resides within a specialized organelle which is known as the…

Q: Describe how the sequence of nucleotides in mRNA codes for the amino acids of a protein. How can the…

A: During the process of transcription the information from DNA is copied into mRNA for protein…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.