4. How does compromised pyruvate kinase activity lead to anemia ?
Q: Which of the following methods can be used to compare the amounts of one specific mRNA that is…
A: A. Immunohistochemistry Deals with the measurement/determination of the distribution of an antigen…
Q: Question 10 Hormones, such as testosterone, estradiol and progesterone are examples of steroidal…
A: Hormones, such as testosterone, estradiol and progesterone are examples of steroidal lipids. True OR…
Q: Explain how the crystal structures of potassium ion channels suggest the way in which the…
A: Potassium channels ubiquitously exist in almost in all kingdoms of life and perform very diverse but…
Q: Gold nanoparticles are applied in cancer therapy; approaches such as photothermal therapy as well as…
A: Photothermal therapy is the process of using electro magnetic radiation for treatment of cancer.…
Q: Which of the following methods can be used to regulate the activity of cyclin-dependent kinases…
A: CDK are the protein kinase which are involved in the regulation of cell cycle.
Q: v Vitamin E A. diminished intestinal absorption of lipids v Vitamin K B. night blindness v Vitamin A…
A: Vitamin are organic chemical compounds that are not synthesised by our body. They are required in…
Q: Second messenger in regulation of metabolism is: Select one: O a. hormones Оb. АТР neurotransmitters…
A: Secondary Messengers are the molecules that act as amplifying components in the cell signalling and…
Q: The steps of glycolysis between glyceraldehyde 3-phosphate and 3-phosphoglycerate do NOT involve:…
A: Glycolysis is defined as the process of breaking down the compound called "glucose" to create…
Q: The reaction catalyzed by glyceraldehyde 3-phosphate dehydrogenase involves two "sub-reactions", one…
A: A mole of NAD is reduced to NADH by glyceraldehyde phosphate dehydrogenase, resulting in…
Q: 1. Foods cannot be compared without determining the “per gram" values. Explain the reasoning behind…
A: Nutrients are substances required by the body, for the growth and development, reproduction, and to…
Q: 2. Glvcolate is oxidized into Glvoxylate by cytochrome Cusing the glycolate oxidase enzyme, The two…
A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…
Q: What carbohydrate is generally detected using the Molisch test? *
A: Carbohydrates are polyhydroxy aldehydes or ketones commonly called as sugars or saccharides.…
Q: Enumerate 10 examples of oxidation-reduction reaction that occur everyday.
A: Oxidation-Reduction reaction is also called redox reaction involves transfer of electron between two…
Q: What is unique about the use of viral gene therapy in cancer immunotherapy
A: Virus have natural ability of delivering genetic material into the cells. Therefore, some of the…
Q: List the different molecules, an electrons is part of, as it moves from NADPH through the…
A: This is the second phase of photosynthesis , after the light dependent phase. It undertakes CO2…
Q: Polysaccharides may gel through a variety of different mechanisms. Which of these statements is…
A: Carbohydrates are divided into 3 classes monosaccharides, disaccharides, and polysaccharides.…
Q: What polysaccharide is used as storage of carbohydrates in humans and animals? Group of answer…
A: Carbohydrates – fibre, starches, and sugars — are nutritional elements that the body converts into…
Q: 3. Based on the name of the following hypothetical drug salts, which of the following statements is…
A: The given options of hypothetical drug can be described as below in terms of acid and base:…
Q: +3 -1.5 +1 +2 -1 +1.5
A: Amino acids are organic molecules having an amino group and an acid group. Amino acids are…
Q: Explain the four stages of biochemical energy production from food which are part of the typical…
A: The which we consume is composed of nutrients like carbohydrates, proteins, and lipids. After…
Q: Is there a possibility that our body is too much of amino acid? If there is, what are the…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group along with a…
Q: What enzyme(s) control the total levels of cGMP in a cell? Is guanylyl cyclase one of the enzymes?
A: Cyclic GMP or cGMP is a second messenger molecule during the process of signal transduction.
Q: 1. What are the three major pathways that eventually become entry points of molecules into the Krebs…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Match the following lipids with their functions
A: Lipids are the various organic compounds which are insoluble in water. These are- fats, waxes,…
Q: What is the direction of transcription in the plasmid shown below? Explain your answer based on the…
A: Transcription is the process of synthesis of RNA using DNA as the template and is catalyzed by
Q: How can human females and males function normally, despite carrying different umbers of the X…
A: Each persons normally has one pair of sex chromosomes in each cell. Females express two X chrmosome…
Q: Both reducing monosaccharide and disaccharide give positive result in Barfoed's test. Which of the…
A: Barfoed's test is done to differentiate between monosaccharide and disaccharide.
Q: Choose the wrong statement: Select one: O a. Competitive inhibitors competing with the substrate O…
A: Enzymes are the biological catalysts, that increase the rate of a chemical reaction. The enzymes may…
Q: 3. When the cellular energy charge is high the cells diverts into fatty acid synthesis. A. pyruvate.…
A: Glucose is the primary source of energy for the body. Glucose is metabolized through the glycolytic…
Q: Question 4 Match the each enzyme deficiency with their corresponding disease B-hexosaminidase A A.…
A: Enzyme deficiency results in certain metabolic disorders and results in serious diseases.
Q: 4. Apolipoprotein B is a protein that binds lipids and carries them around the body. One of the two…
A: The rate of translation varies amongst prokaryotes and eukaryote. In prokaryotic cells this rate is…
Q: does HEW have a higher concentration of negatively/neutral charged protein (at ph 7) explain ur…
A: HEW ( hen egg white) is an enzyme specifically known for its ability to degrade the polysaccharide…
Q: 1. Proteins act as structural components such as keratin of hair and nail, the collagen of the bone…
A: "Since you have posted a question with sub-parts we will answer the first 3 question for you. If you…
Q: RI `R? OH
A: DAG is an important lipid it can act as signaling lipid or intermediate in biosynthesis pathway,
Q: Using the concept of complementary base pairing, write the complementary DNA strands, with their 5'…
A: The DNA molecule generally has two strands that wind around one another to form a shape is generally…
Q: - RNA can take part in eukaryotic intron splicing but DNA cannot. Describe in technical detail why…
A: Splicing is a process of removal of non-coding (introns) regions from the gene. Incase of…
Q: what transport proteins are involved is getting ca2+ out of cytosol
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: C17H29COOH linolenic acid non-saponifiable ω-3 fatty acid All are correct
A: Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain…
Q: The portion (the C-terminal end) of original substrate with the new amino terminus diffuses away.…
A: Introduction: Enzymes have a spectacular ability to accelerate the rate of a chemical reaction.…
Q: Several tablespoons of Vitamin C are placed in an empty bottle containing only air. The botle is…
A: Vitamin C is also referred to as ascorbic acid, is a water-soluble nutrient found in some foods. It…
Q: Progesterone is mainly responsible for the development of sexual characteristics and function O True…
A: Progesterone is a C-21 steroid hormone. Cholesterol is the precursor for progesterone. Progesterone…
Q: Principle involved in the isolation of gluten * (Please choose one correct answer only) A.…
A: The protein component of wheat flour is called Gluten. This basic component gives elasticity and…
Q: Which statement is FALSE concerning glycolysis? Group of answer choices It is activated by high…
A: Glycolysis isa catabolic pathway that occurs in cytosol by breaking down of glucose into pyruvate…
Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…
A: Dominant allele of a gene expresses phenotype even if it present in single copy. So dominant…
Q: lood group A has A antigen on the red blood cells with anti-A antibodies in the plasma. O True O…
A: Introduction: The ABO blood group system is the most common blood type system in human blood…
Q: The vast majority of structures deposited in the Protein Databank (>95%) have been determined using…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: What glycolytic intermediate does glycogenolysis produce? Explain in brief..
A: Glycolysis is a metabolic pathway in which glucose is converted to pyruvate. The principal sugars…
Q: HO CH, H. CH2 OH I-
A: An amino group and an acid group-containing organic molecules are called Amino acids. when…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: 4. A solution containing egg albumin (pl-4.6), B-lactoglobulin (pl-5.2), and chymotrypsinogen…
A: Based on their isoelectric point, protein purification can be done in an ion-exchange column (pI).…
Step by step
Solved in 2 steps
- 2. A 4-year-old girl was diagnosed with thiamine deficiency and the symptoms include tachycardia, vomiting, convulsions. Laboratory examinations reveal high levels of pyruvate, lactate and a-ketoglutarate. Explain which coenzyme is formed from vitamin B, and its role in oxidative decarboxylation of pyruvate. For that: a) describe the structure of pyruvate dehydrogenase complex (PDH) and the cofactors that it requires; b) discuss the symptoms which are connected with the thiamine deficiency and its effects on PDH and a-ketoglutarate dehydrogenase complex; c) explain the changes in the levels of mentioned metabolites in the blood; d) name the deseribed discase,7. Explain the differences between Glycogenolysis in muscle and liver.5. Reciprocal regulation of glycogen phosphorylase and glycogen synthase activity.
- 1. There are two metabolic routes for the conversion of oxaloacetate to phosphoenolpyruvate (PEP). What factors likely indicate which route is used? Do the two routes have different requirements for cellular energy (e.g. ATP)? 2. Compare the export of glucose from hepatocytes to the import into hepatocytes. 3. Would you expect anaplerotic reactions to be active in the postprandial hepatocyte? Why?How does compromised pyruvate kinase activity lead to anemia?5. When the acetyl-CoA produced during B-oxidation in the liver exceeds the capacity of the citric acid cycle, the excess acetyl-CoA forms ketone bodies-acetone, acetoacetate, and D-b-hydroxybutyrate. This occurs in severe, uncontrolled diabetes: because the tissues cannot use glucose, they oxidize large amounts of fatty acids instead. Although acetyl-CoA is not toxic, the mitochondrion must divert the acetyl-CoA to ketone bodies. What problem would arise if acetyl-CoA were not converted to ketone bodies? How does the diversion to ketone bodies solve the problem?
- 13. What is the consequence of complete inhibition of all mutases in liver cells? A. Liver cannot provide free glucose to maintain blood glucose levels B. Glycogen synthesis is disrupted C. Glycerol cannot be converted to glucose D. The only fate of glucose-6-phosphate is to be converted to fructose-6-phosphate3. Which tissues can synthesize glucose through the gluconeogenesis pathway? Explain the reason.What are the current treatments for Pyruvate Kinase Deficiency (PKD) patients?
- 5. Which of the following enzymes is NOT used when fructose is metabolized to pyruvate in the liver? a. triose phosphate isomerase b. glyceraldehyde-3-phospate dehydrogenase c. glucokinase d. phosphofructokinase-1 e. pyruvate kinase4. Which of the following statements regarding the coordinated regulation of glycolysis and gluconeogenesis is not true? A. Phosphofructokinase-1 (PFK-1) and fructose-1,6-bisphosphatase (FBPase-1) are reciprocally regulated. B. Activating PFK-1 leads to more glycolysis. C. Inhibiting FBPase-1 slows gluconeogenesis. D. Fructose-1,6-bisphosphate is the primary regulator of PFK-1 and FBPase-1. E. ATP inhibits PFK-1.8. Hypercholesterolemia is a frequent complication of diabetes mellitus in patients with prolonged hyperglycemia. Why a high level of glucose in blood causes hypercholesterolemia and atherosclerosis? For the answer explain: a) how glucose can interact with the proteins and the consequences of this reaction for the proteins; b) glycation of which proteins results in hypercholesterolemia; c) possible causes and complications of hypercholesterolemia.