3. With a deficiency of thiamine - vitamin B1, beriberi disease (polyneuritis) occurs and carbohydrate metabolism is disturbed. What metabolite accumulates in the blood? Justify the answer.
Q: 1) A ligand-binding protein showing negative homotropic cooperativity? a) should give an nH value…
A: Cooperativity or cooperative binding occurs when binding of one molecule influences the affinity of…
Q: 2. Enzymes of the pyruvate dehydrogenase complex.
A: PDC is a multienzyme complex that catalyzes the conversion of pyruvate to acetyl-CoA via glycolysis.…
Q: Draw the structure of ethanolamine sphingomyelin formed from linoleic acid Draw the structure of…
A: Sphingomyelin is an important component of both the monolayer of phospholipids in lipoproteins and…
Q: [Select] [Select] [Select] transport. V transport. would move across a membrane using simple…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: What amino acids are possibly present in each sample tests? Explain why.
A: Proteins are folded peptides. Peptides are made up of amino acid residues linked via a peptide bond.…
Q: Choose the best answers for each missing word from the list below. (1)__________ is a first…
A: Biochemical cell signalling is the method by which cell communicates with each other cells and…
Q: 2. Complete the following for serine, tyrosine, and gylcine. a. Draw the amino acid. b. Circle the…
A: Amino acids are the building blocks of proteins. they can be classified into different groups based…
Q: a. What hormone is released in response to increased blood glucose? 2. b. The binding of this…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: If two molecules of palmitoyl acid enters the beta-oxidation, how many acetyl-CoA and NADH molecules…
A: Beta oxidation : This is the process of catabolism of fatty acids by removing a two carbon moiety…
Q: A gene for albumin has 5 exons. When the DNA from this gene is allowed to hybridize with nuclear…
A: Introduction DNA is a self replicating molecule. mRNA is formed from DNA by a process called…
Q: A pentapeptide has the abbreviation "GREAT". Draw the peptide and give its systematic name.
A: Peptides are short sequences of amino acids. Amino acids in a peptide are joined together through…
Q: How can an unfavorable reaction (AG°¹ > 0) still occur in a metabolic pathway? By increasing the…
A: Metabolic reactions are the biochemical reactions that are essential for our cells to get energy…
Q: Q10.1: Answer the following three-part question. a) Calculate the ΔEº’ for the citrate cycle…
A: Converting malate to oxaloacetate: The regeneration of oxaloacetate in the citric acid cycle is…
Q: From the three figures below, indicate which represents best the catalytic pocket of trypsin, a…
A: Serine proteases are the group of enzymes that cleaves the peptide bond in proteins, where Ser…
Q: Which of the following first messengers is hydrophobic and binds to a nuclear receptor protein…
A: The first messengers are extracellular biomolecules that bind to the cellular receptor and elicit a…
Q: A cyclic AMP (CAMP) binding protein was isolated from mammalian cells and characterized by…
A: Given that,The ligand is cAMPThe receptor is cAMP binding protein (CBP)also the concentration of CBP…
Q: ----------------------the simplest lipids but they may be a part of or a source of many complex…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: The enzyme-catalysed conversion of a substrate at 25 °C has a Michaelis constant of 70 μmol dm and a…
A: The enzyme follows Michaelis Menton's kinetics. Kcat is the enzyme turnover number and it defines…
Q: An unknown sample was tested if there is a presence of lipid, after the test it shows that it is…
A: These are the various preliminary and qualitative tests to estimate the presence and nature of…
Q: How does the degree of unsaturation and structure of fats affect its functionality, for example in…
A: Triglycerides or triacylglycerides or simple fats are fatty acid esters of glycerols. In…
Q: A portion of a single strand of DNA is shown below, which contains a amino acid-coding sequence.…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: can you explain this again in a different way
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: The Electron Transport System (ETS) The ETS must generate a hydrogen gradient (proton motive force)…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: 1. Define a polynucleotide. 2. What are the types of polynucleotides? 3. Enumerate and classify all…
A: Nucleotides are the complex compounds made up of nitrogen base, a sugar residuw and a phosphate…
Q: De novo purine biosynthesis is a 10-step pathway that builds the purine rings one atom, or one group…
A: Nucleotides are building blocks of nucleotides. It consists of a nitrogenous base linked to 1'…
Q: What is the main advantage of fluorescence polarization? Sensitivity of fluorescent probes Low cost…
A: FP is an analytical technique which provides information on orientation and mobility of…
Q: Please describe four different modes of the regulation of the pentose phosphate pathway.
A: Introduction:- The Question is all about the pathway of pentose phosphate cycle that synthesis via…
Q: Name the compound: 1. Lys-Ile-Met-Val Draw the forms of the amino acid in the solution. 2.…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: 1. Compute the concentration of the standard solutions by completing Table B.1. Report your answers…
A: Bradford assay is a method to estimate the protein concentration in the given sample. It is based on…
Q: Maargerines made from plant oils are healthier, since they are hydrogenated for spreadability?…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Uncouplers of oxidative phosphorylation are all expect: Select one: O a. thermogenin O b.…
A: INTRODUCTION: (Oxidative phosphorylation) The process by which ATP is formed as a result of the…
Q: Write a short description of the physical characteristics of acid & enzymatic hydrolysates. What…
A: Introduction: The principle of the benedict test is that when reducing sugars when heated in the…
Q: 6. Biological value of glycogen breakdown in muscles and liver.
A: Carbohydrates are biomolecules that are utilized as the primary source of energy. And glucose is the…
Q: * 15-14 AG AG is +6.64 kJ/mole +1.59 kcal/mole for the reaction Citrate - = Isocitrate. is -267…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: Please depict a noncovalent interaction important for the function of lysozyme
A: Lysozyme: An enzyme called lysozyme breaks down the polysaccharides in bacterial cell membranes.…
Q: What percentage of molecules of peptide GGGG has no ionized groups (e.g. has BOTH protonated…
A: Amino acids: An amino acid can function as both an acid and a base because of its structural…
Q: 3. Question from Lehninger...describe the common structural features and the differences for each of…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. They are…
Q: Metabolic Integration Q9.1: Glucose-6-phosphate is a key metabolic intermediate in four major…
A: Glucose-6-phosphate is the key metabolic intermediate where it is branched to four major metabolic…
Q: [1-14C] Ribose 5-phosphate is incubated with a mixture of purified transketolase, transaldolase,…
A: The pentose phosphate pathway consists of 2 phases; Oxidative and Non-oxidative phase. In the…
Q: Secondary messengers and their role in the mechanisms of hormonal influence on target cells:…
A: Phosphatidylinositol (PtdIns) is a lipid molecule composed of an inositol ring and two fatty acid…
Q: 2. What molecule does not bind to hemoglobin? O (a) Carbon monoxide (CO) O (b)…
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: 1. Explain why lipids are insoluble in polar solvents. 2. How do oils and fats differ?
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Describe how the results of carbon-14 labeling experiments demonstrated that the citrate cycle is a…
A: The citric acid cycle involves the oxidation of acetyl-CoA into carbon dioxide and water. It is the…
Q: 5. Consider the fatty acid. Which of the designations are accurate for the fatty acid? -O O A) (0-6…
A: Fatty acids are the monomer units for the lipid biomolecules. Fatty acids are classified into…
Q: Using the results of linear regression analysis (log(MW, kDa) vs Rr) from the protein standards,…
A: Given that the linear regression analysis data of a plot of Log MW (in kDa) vs Rf is given as:…
Q: The following is a(n) [Select] [Select] V [Select] disaccharide with a(n) glycosidic bond.
A: Disaccharides are sugars which are formed as a glycosidic bond is formed between 2 monosaccharides.…
Q: Discuss three of the major steroids derived from cholesterol and their physiological role.
A: Lipids are a chemically diverse group with two common characteristics: low solubility in water and…
Q: Which of the following is an anomer of B-D-gulopyranose? O ОН I ОН т ОН I I ОН CH2OH II- Б ОН CH2OH…
A: Anomers are cyclic monosaccharides differing from each other in the configuration at carbon no -1…
Step by step
Solved in 2 steps
- 7. Describe in detail the clinical manifestations of diabetic ketoacidosis.8. Discuss the management of diabetic ketoacidosis.3. A patient has got excess carbohydrate meal for the years and gain the weight. To explain this: a) draw the schemes of TAG synthesis in the liver; b) describe the transport of TAG from the liver to adipose tissue; c) describe the functions of insulin in the conversion of glucose to TAG in the liver and adipose tissue. Glucose containing Catoms was added to isolated hepatocytes inanexperiment. Ifthe glucose was added in excess, the rate of triacylglyccrol synthesis increased.
- 3. Write 3 of the causes of hyperglycemia and explain.8. In patients with diabetes mellitus type I, the biochemical disorders result from changes in fucl metabolism. One of these signs is acidosis. Explain why such patients have a deviation of blood pH from the norm? For this me the Ocuics, name d) specify the hormone that accelerates this preeursor formation and provide appropriate charts, starting from the hormone binding to adipocyte and concluding with precursor formation, give an explanation to the charts.6. Describe in detail the etiology and pathophysiology of diabetic ketoacidosis.
- 1. Describe the clinical significance associated with abnormal levels of cholesterol 2. How does liver disease affect the cholesterol levels in the blood 3. Describe completely the lipoprotein metabolism.1.Explain why glutathione can confer therapeutic benefit when taken orally. 2. What is the physiological manifestation of Gout and how can it be avoided? 3.Differentiate Lesch-Nyhan Syndrome and Gout.26: Regarding thioamides: ese (a) they include chlorambucil (b) methimazole is less potent than propylthiouracil (c) the bioavailability of propylthiouracil is less than 25% (d) their prolonged use may result in gastrointestinal distress (e) the most dangerous complication is agranulocytosis
- 91.ONE of the following statements is INCORRECT regarding misoprostol : A- It has no effect on acid secretion B- It is not a component of triple therapy of H pylori 3- It increases mucus production and bicarbonate secretion 4- May cause diarrhea 5- It significantly increase gastric mucosal blood flow17. Accumulation of high levels of chloramphenicol in newbom that leads to a gray baby syndrome is due to он H .CHCI2 O,N- но chloramphenicol A. Lack of UDP-glucuronosyltransferase B. Renal uptake of metabolized product C. High lipophilicity of chloramphenicol D. Poor absorption of chloramphenicol 161. Discuss fully the synthesis of triacylglycerol in the adipose tissue, muscles, intestines and liver. 2. Describe adequately the beta-oxidation of fatty acids. 3. Discuss the synthesis and utilization of ketone bodies.