(a)
To determine: The fraction of the total haploid genome that the 500 copies of the ribosomal RNA genes represent.
Introduction: The genes encoding ribosomal RNA during oogenesis in Xenopus laevis is the best studied example of gene amplification. The unamplified number of ribosomal RNA genes is about 500 per haploid genome. After amplification, the oocyte contains about 500,000 ribosomal RNA genes per haploid genome. This level of amplification is necessary to allow the egg cells to synthesize 1012 ribosomes that accumulate during the two months of oogenesis in this species. Each ribosomal RNA gene consists of about 13,000 base pairs, and the genome size of Xenopus is about
(b)
To determine: The total size of the genome after amplification of the ribosomal RNA genes and the proportion of this that the amplified ribosomal RNA genes represent.
Introduction: The genes encoding ribosomal RNA during oogenesis in Xenopus laevis is the best studied example of gene amplification. The unamplified number of ribosomal RNA genes is about 500 per haploid genome. After amplification, the oocyte contains about 500,000 ribosomal RNA genes per haploid genome. This level of amplification is necessary to allow the egg cells to synthesize 1012 ribosomes that accumulate during the two months of oogenesis in this species. Each ribosomal RNA gene consists of about 13,000 base pairs, and the genome size of Xenopus is about
(c)
To determine: How long oogenesis would have to extend if the genes had not been amplified.
Introduction: The genes encoding ribosomal RNA during oogenesis in Xenopus laevis is the best studied example of gene amplification. The unamplified number of ribosomal RNA genes is about 500 per haploid genome. After amplification, the oocyte contains about 500,000 ribosomal RNA genes per haploid genome. This level of amplification is necessary to allow the egg cells to synthesize 1012 ribosomes that accumulate during the two months of oogenesis in this species. Each ribosomal RNA gene consists of about 13,000 base pairs, and the genome size of Xenopus is about
(d)
To determine: The reason why genes have to be amplified when the gene product needed by the cell is RNA but not usually when the desired gene product is a protein.
Introduction: The genes encoding ribosomal RNA during oogenesis in Xenopus laevis is the best studied example of gene amplification. The unamplified number of ribosomal RNA genes is about 500 per haploid genome. After amplification, the oocyte contains about 500,000 ribosomal RNA genes per haploid genome. This level of amplification is necessary to allow the egg cells to synthesize 1012 ribosomes that accumulate during the two months of oogenesis in this species. Each ribosomal RNA gene consists of about 13,000 base pairs, and the genome size of Xenopus is about
Want to see the full answer?
Check out a sample textbook solutionChapter 20 Solutions
Becker's World of the Cell (9th Edition)
- Lunatic fringe (Lfng) expression in Examine the figure and answer these questions: WT and DLL3pu mouse embryos wt DII3pu a wt d DI13 1.1 Compare the expression pattern of Lfng in one period of somitogenesis between the WT and DI13Pu mutants (panels a-f), where is the gene expressed and what is different? (3 points) 1.2 In panels g and h, the embryo was bisected and one side fixed right away and the other incubated for ½ of a single somitogenesis cycle. Compare the change in Lfng expression in the two genotypes at time 0 and time +45. What can we conclude from this experiment? (2 points) garrow_forwardPart I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'arrow_forwardYes or no only. rna seq can provide sequence and expression data do riboprobes synthesize bu in vitro transcription? does rna causes mutations and lose of function of specific genes?arrow_forward
- Research cancer mutation. Provide the link to the research article that gives you your information. One good resource to use is PubMed. Then answer the following questions, in 3 paragraphs, 3-5 sentences each. 1. What kind of disease/cancer does this mutation cause? 2.What happens during transcription to cause this mutation? 3. Is this trait passed on to progeny? Can the progeny be a carrier or simply affected?arrow_forwardprotein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the short guide RNA complementary to the first exon of Gene Y is expressed in all tissues. You subsequently sequence Gene Y in both brain and liver tissue. What would expect in each tissue? You can assume that the CRISPRICas9 system will impact both copies of Gene Y in cells, and that the first exon of Gene Y is necessary for Gene Ys function. a. Liver: Functional Gene Y; Brain: Functional Gene Y b. Liver: Nonfunctional Gene Y; Brain: Funtional Gene Y c. Liver: Functional Gene Y; Brain: Nonfunctional Gene Y d. Liver: Nonfunctional Gene Y; Brain: Nonfunctional Gene Yarrow_forwardPls answer ASAP. Sec61 is a protein involved in the formation of the translocon for ER-targeted proteins. What would happen to the proteins targeted to the Golgi Apparatus in a mammalian cell in which the Sec61 is mutated?arrow_forward
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.arrow_forwardDisdis -how do RB and p53 negatively regulate the cell cycle in G1? describe the events that occur in the initiation and elongation of DNA replication in S phase.arrow_forwardI am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…arrow_forward
- Gene Expression and the Impact of a Mutation. Can someone help me to answer the question 8 and 9, please? 8. How has the mutation altered the polypeptide? Is the function of the hemoglobin molecule (which includes 2 ẞ-globin polypeptides and 2 a-globin polypeptides) impaired? (Read your book to learn more about sickle cell disease.) 9. What is the relationship between the genotype in this case and the individual's phenotype? asap pleasearrow_forwardPolymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forwardVariations in Gene Expression In humans, the glucose-6-phosphate dehydrogenase (G6PD) gene involved in sugar metabolism is X-linked. The dominant allele (G) codes for fast enzymes for normal cell functioning while the recessive allele (g) codes for slow enzymes, which are responsible for the reduced enzymatic activity of cells. However, the presence of slow enzymes has minimal effect in the overall functioning of heterozygotes, thus normal. Recessives, however, are more prone to oxidative reactions that speed up the cell damaging process, thus weak (but not lethal). If random inactivation occurs during dosage compensation, what would be the genotypes and phenotypes of the children of a heterozygous mother and a recessive father? with COMPLETE crossarrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning