Becker's World of the Cell (9th Edition)
Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
bartleby

Videos

Question
Book Icon
Chapter 20, Problem 20.4CC
Summary Introduction

To determine: The part of the glp-1 mRNA which is affected because of which the protein GLP-1 is now expressed in all four cells.

Introduction: While studying the protein GLP-1 in C. elegans, a protein which is found in only two of the four cells of the early embryo, a mutation was seen in a region of the glp-1 gene which encodes an exon, but does not affect the sequence of the GLP-1 protein. The mutation caused the protein GLP-1 to now be expressed in all four cells.

Blurred answer
Students have asked these similar questions
A Drosophila egg that is bed lbcd may develop normally, but the adult fruit fly will not be able to produce viable offspring. How is this possible? The mother can provide the bcd mRNA required for normal development, but the adult bcd /bcd female fly cannot make its own bcd mRNA. The Hox genes in the egg play a redundant role to bcd during development in a bcd / bcd egg, but reproduction requires bcd. Drosophila sperm contains the functional bcd gene product required for normal development, but the adult sex cells will not be able to produce the functional product. The nanos gene product functionally compensates for lack of bcd expression in the developing fly but not in its offspring.
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.   You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?               You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?     5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’         After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
In the sea urchin, early development may occur even in the presence of actinomycin D, which inhibits RNA synthesis. However, if actinomycin D is present early in development but is removed a few hours later, all development stops. In fact, if actinomycin D is present only between the sixth and eleventh hours of development, events that normally occur at the fifteenth hour are arrested. What conclusions can be drawn concerning the role of gene transcription between hours 6 and 15?
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY