Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 20, Problem 20.4CC
Summary Introduction
To determine: The part of the glp-1 mRNA which is affected because of which the protein GLP-1 is now expressed in all four cells.
Introduction: While studying the protein GLP-1 in C. elegans, a protein which is found in only two of the four cells of the early embryo, a mutation was seen in a region of the glp-1 gene which encodes an exon, but does not affect the sequence of the GLP-1 protein. The mutation caused the protein GLP-1 to now be expressed in all four cells.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A Drosophila egg that is bed lbcd may develop normally, but the adult fruit fly will not be able to produce viable offspring.
How is this possible?
The mother can provide the bcd mRNA required for normal development, but the adult bcd /bcd female fly cannot
make its own bcd mRNA.
The Hox genes in the egg play a redundant role to bcd during development in a bcd / bcd egg, but reproduction
requires bcd.
Drosophila sperm contains the functional bcd gene product required for normal development, but the adult sex cells
will not be able to produce the functional product.
The nanos gene product functionally compensates for lack of bcd expression in the developing fly but not in
its offspring.
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.
You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?
You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?
5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’
3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’
After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
In the sea urchin, early development may occur even in the presence of actinomycin D, which inhibits RNA synthesis. However, if actinomycin D is present early in development but is removed a few hours later, all development stops. In fact, if actinomycin D is present only between the sixth and eleventh hours of development, events that normally occur at the fifteenth hour are arrested. What conclusions can be drawn concerning the role of gene transcription between hours 6 and 15?
Chapter 20 Solutions
Becker's World of the Cell (9th Edition)
Ch. 20 - Suppose you are analyzing a haploid E. coli strain...Ch. 20 - How do epigenetic changes, such as DNA...Ch. 20 - Compare the basic state of a gene in bacteria...Ch. 20 - Prob. 1QCh. 20 - Prob. 20.4CCCh. 20 - Prob. 20.1PSCh. 20 - The Pickled Prokaryote. Pickelensia hypothetica is...Ch. 20 - Prob. 20.3PSCh. 20 - Attenuation in 25 or Fewer Words. Complete each of...Ch. 20 - Prob. 20.5PS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You are interested in the effects of mutations on the expression of a human protein- encoding gene expressed in skin cells. The gene has one intron that is 450 nucleotides long. After this intron is removed from the pre-mRNA, the mRNA transcript is 1100 nucleotides in length. Diploid somatic cells have two copies of this gene. Predict the size and amount of mRNA from the cytosol of skin cells, which were obtained from the following individuals: • Individual 1: Normal individual with no mutations in this gene. • Individual 2: Homozygous for a deletion that removes the -10 to -100 region of the gene that encodes this mRNA. • Individual 3: Heterozygous in which one gene is normal and the other gene has a deletion that removes the -10 to -100 region. • Individual 4: Homozygous for a five-nucleotide deletion in the intron that removes the GT sequence at the 5' splice site. Explain your answers.arrow_forward. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNAarrow_forwardYou are working with a fly hair cell developmental system. This Notch/Delta-regulated system results in clusters of cells where the central one differentiates into a specialized hair cell. To better understand this system you have tagged the C-terminal cytoplasmic domain of Notch with GFP. You have done a forward genetic screen to look for mutants that have unusual phenotypes in this Notch system. The first one is a mutation in Notch itself. This mutant is in the ADAM10 cleavage site and blocks proteolysis. Draw the expected outcome for such a mutant: GFP localization and developmental outcome 24hr after differentiation. WT before differentiation WT 24 hours after differentiationarrow_forward
- The transcription factor Pax6 is required continually during the life of a mouse (or a human) for the development of the retina. Homozygous Pax6 knockout mice die soon after birth because Pax6 protein is also required in essential organs, such as the pancreas. a) In order to study the role of Pax6 in eye development a researcher wants to generate a mouse that expresses Pax6 everywhere except in its eyes. Describe how you could construct such a mouse by floxing the gene. Is it possible to achieve the same end with a transgene? (Hint: think about using cDNA and RNAI) b) Suppose you want to create a mouse similar to that in part (a), but one where the eye cells from Pax6 function has been removed and now express a gene that specifies a green fluorescent protein (GFP). Marking the cells in this way will allow the investigators to see the shapes of the Pax6- eye cells more easily than if they did not express GFP. Diagram a Pax6 gene construct that would enable the researcher to do this…arrow_forwardYou are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II and transcription factors would bind From the list given - choose all components that you think are part of a typical eukaryotic gene From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expressionarrow_forwardSuppose expression of gene A is limited to the middle part of the early mouse embryo. Expression of gene B is located on the posterior and anterior ends of the early mouse embryo, but not in the middle. When gene B is mutated, expression of gene A is distributed over the whole embryo. What is a likely explanation for this data? a) Gene A acts as an activator of gene B. Ob) Gene A acts as a repressor of gene B. O c) Gene B acts as an activator of gene A. () d) Gene B acts as a repressor of gene A.arrow_forward
- Progesterone is a steroid hormone (also described as a ligand) that prepares the body for pregnancy. It binds to the progesterone receptor (PR) protein in the cytoplasm of various cells. Ligand bound PR acts as a transcriptional activator, binds to the DNA in the promoter region of several genes and leads to transcriptional activation of these genes. Ligand bound PR has been shown to increase the expression of a gene, FKBP5. You are studying the activity of wild-type (WT) and mutant PR in cells by examining expression of FKBP5. Results are obtained as shown in the figure below, where the asterisk indicates when progesterone was (or was not) added to the cells. From the results, which of the following statements can be concluded? WT PR without progesterone WT PR with progesterone Time Time mutant PR without progesterone mutant PR with progesterone Time Time The wild-type PR is unable to increase FKBP5 expression in the absence of ligand The wild-type PR increases FKBP5 expression after…arrow_forwardWhat would be the most likely result of injecting bicoid mRNA into the posterior end of a Drosophila embryo and inhibiting the translation of nanos mRNA?arrow_forwardAnother way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subsequent development of the embryo, larva, and adult. For example, if Bicoid protein is injected into the posterior region of an oocyte, the resulting embryo will develop into a larva that has anterior structures at both ends. Based on your understanding of the function of each developmental gene, what would be the predicted phenotype if the following proteins or mRNAs were injected into normal oocytes? A. Nanos mRNA injected into the anterior end of an oocyte B. Antp protein injected into the posterior end of an embryo C. Toll mRNA injected into the dorsal side of an early embryoarrow_forward
- What would be the most likely effect of inhibiting the translation of hunchback mRNA throughout a Drosophila embryo?arrow_forwardYou have been analyzing wing development mutants in Drosophila and have collected the genetic/Western data below. Your epistasis analysis (not shown), suggested your current model that DW-2 is upstream of WL-1. What is a plausible mechanism for how DW-2 regulates WL-1? mutant name wingless-1 doublewing-2 Prated with Ants-Wingless MW standards || | | mutanttype ODW-2 inhibits transcription of WL-1 O DW-2 polyubiquitinates WL-1 null null phenotype Model Ac O DW-2 phosphorylates WL-1 and prevents it from entering the nucleus O DW-2 cleaves WL-1 proteolytically Wings Mode of regulation DW-2 Wings Wingsarrow_forwardProgesterone is a steroid hormone (also described as a ligand) that prepares the body for pregnancy. It binds to the progesterone receptor (PR) protein in the cytoplasm of various cells. Ligand bound PR acts as a transcriptional activator, binds to the DNA in the promoter region of several genes and leads to transcriptional activation of these genes. Which of the following statements must be true for the PR protein? O Ligand binding to the PR results in a conformational change in the primary structure of the protein The domain/region of the PR protein that interacts with the DNA, has basic amino acids Ligand binding to the PR results in a conformational change in the tertiary structure of the protein The domain/region of the PR protein that interacts with the DNA, has acidic amino acidsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY