The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!

The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!

Name: The coding DNA strand of a gene has the following DNA sequence: 5’ ATG
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene3) A mutatio

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the Tis substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
2) Create an MRNA strand based on the given DNA template strand: TACTTCCTATTITCTTGTCA CCGCACT 3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA sequence determined in question 3. 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?
Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the complementary DNA sequence that would form the double helix: 2. Write the sequence of the mRNA transcript that would be produced from transcription (use the original sequence, not the complement you just wrote): 3. Now, using the mRNA transcript and the table, write the amino acid strand produced from translation:
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'