The phosphates that make up the phosphodiester bonds in DNA have pka 2. The genome of the blue crab is 800 long. What is its total charge on the blue crab genome in aqueous buffer solution when the pH is equal million-base-pairs to 2.25?
Q: For the reaction A + 2 B 3 C + D, what is the magnitude of the rate of change for [D] when [C] is…
A:
Q: 3. A student in my lab was trying to express the cytosolic (not membrane bound) enzyme PseG and…
A: The expression of proteins in a prokaryotic or eukaryotic cell involves transcription and…
Q: The reaction S-> P is catalyzed by an enzyme that follows Michaelis-Menton kinetics. From the…
A: The rate of enzyme catalyzed reaction that is the enzyme kinetics can be expressed by the…
Q: b) How does oxygen availability determine the fate of the glycolysis pathway?
A: Glycolysis is a central metabolic pathway that is used by all cells for the oxidation of glucose for…
Q: The child who fainted was taken by ambulance to the hospital. Objectively: reflexes are absent,…
A: The following steps will explain how accumulation of a specific metabolite leads to appearance of…
Q: A 24-residue peptide called Pandinin 2, isolated from scorpion venom, was found to have both…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Many enzyme -catalyzed reactions are consistent with a modified version of the Michaelis -Menten…
A: E+S⇌k-1k1Es⇌k-2k2E+P.......................(1) Considering above Michaelis Menten Equation where…
Q: Write a scheme for the synthesis of mevalonic acid as the first stage of cholesterol synthesis.…
A: Cholesterol is a sterol found in the plasma membrane that has the characteristic steroid nucleus (4…
Q: 12. Which of the following ligands cannot act as an ambidentate ligand? o nitrite, NO₂ o…
A: Ligand is a molecule which bind reversibly to the protein. A ligand may be any kind of molecule, it…
Q: ✓ Part B What further experiment should be carried out in order to determine the primary structure…
A: Introduction Protein is the most abundant macromolecule in our body. Amino acids are the building…
Q: 1.a) Which one of the following would be a component of innate immunity? antigen SARS-CoV-2…
A: Innate immunity can be defined as the general non specific immune response that is developed by…
Q: In protein structure, which is not established via secondary interactions? o tertiary o secondary o…
A: Proteins are polymers of amino acids linked by peptide/amide bond with release of one water molecule…
Q: A TCL was run with 5 subjected samples utilizing a silica plate and ethanol/chloroform in mobile…
A: TLC (thin layer chromatography) is a type of partition chromatography, in which the samples are…
Q: ~0.766+ 47425 y-0.568x46576 . . . . . X The inhibitor binds at the active site. The inhibitor binds…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: he initial velocity data shown in the table were obtained for an enzyme. Each assay at the…
A: Michaelis-Menten described the relationship between reaction velocity and substrate concentration.…
Q: Where do the atoms come from to make carbohydrates, lipids (fats), and proteins?
A: INTRODUCTION : Atoms : Atom is the smallest unit of any organism, particle, metal, non metal or any…
Q: explain the following prperties of G protein: structure of G- activation cycle and signaling pathway…
A: G proteins are the Guanine nucleotide binding proteins which functions in transducing signals…
Q: What is the effect on the biosynthetic pathways if the oxidative branch of a person’s pentose…
A: The pentose phosphate pathway (PPP) is an alternate pathway to metabolize Glucose 6-phosphate…
Q: 1.In this model, the substrate still needs to fit into the enzyme like a key, but instead of simply…
A: Since you have posted multiple questions, we will provide the solutiononly to the first five…
Q: Calculations for the Purification of a Recombi- nant Protein The purification of a recombinant…
A: The goal of this calculation is to determine the efficiency and success of each purification step…
Q: The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn…
A: Proteins are polymers of amino acid residues linked via peptide bonds. Amino acids are biomolecules…
Q: In the folded protein, His108 forms a salt bridge with Asp44. The pKa of the imidazole functional…
A: pKa is the pH at which a weak acid is 50% dissociated into H+ and conjugate base. Also, pKa = -log…
Q: The table below gives the initial velocities of a decarboxylase, determined at various [S], in the…
A: Km is the Michael's menton constant which can be determined as the substrate concentration at half…
Q: 3. If PCR were performed on a highly conserved gene from two species, one prokaryotic and one…
A: A conserved gene is a gene that has remained largely unchanged over a long period of evolutionary…
Q: - Calculate ammonium sulphate, NADH, a-ketoglutarate and proteins concentrations in the reaction…
A: In order to calculate the concentration of species in the reaction medium at time =0, we need to…
Q: In which phase of aerobic respiration is the main part of ATP formed? Electron transport chain…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: The radiolabel shown on the image in glycogen is used for conversion to ribose 5-phosphate while…
A: Glycogen is a polysaccharide and the storage form of carbohydrates in animals. It is a homopolymer…
Q: Select lipid samples under triacylglycerol (one simple and one mixed), phospholipid, and…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Q: 7. You have a 200 mg/mL stock solution of protein. To make 20mL of 5mg/mL solution, add of stock and…
A: Dilution results in a decrease in the concentration of a substance in a mixture. A stock solution is…
Q: Plant cell walls are made out of ___ Select one: a. a polymer, cellulose b. a three carbon molecule,…
A: Cell walls that surround plant cells are primarily made of complex polysaccharides.
Q: 1.a)Which one of the following vitamins is fat-soluble? Vitamin B12 Vitamin D Vitamin B1 Vitamin B3…
A: Introduction Vitamins are the organic substances which is required for our growth and development.…
Q: differentiate the intermdeiates in term of theri reaction with lugol's solution and benedict…
A: Starch is the main source of carbohydrates, it is commonly found in nature. The foods like,…
Q: Which of the following statements is NOT true of biological organic molecules? Their atoms are…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Give the molecular and structural formulae for: –2 examples of structural isomers of monosaccharides…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Describe how each of the following relates to protein configuration: primary structure - secondary…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: 2. A mutation that changes an alanine residue in the interior of a protein to valine (A157 → V157)…
A: Different protein gain its three dimensional structure after folding, which occurs according to the…
Q: IDENTIFICATION: 1.Complex organic compound w/c has the ability of speeding chemical reactions w/out…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: Aerobic catabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in the TCA cycle…
Q: Write schematically the synthesis of phosphatidylethanolamine through the activation of amino…
A: INTRODUCTION : Phospholipids : They are a group of biochemical compounds which are made up of fatty…
Q: OBJECTIVE & SCOPE OF THE PROJECT The scope of the project is to prediction of crops can be informed…
A: The objective of this project is to use advanced Machine Learning techniques to predict crop yields…
Q: 1. What is Du? ESTIONS ON LABORATORY ASSAY NO.7 2. Why do we need test for Du when weak or no…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: This SDS-PAGE loading buffer has SDS (a denaturing detergent), β-mercaptoethanol (a reducing agent),…
A: DF can be expressed as ratio of concentrations and as ratio of volumes. DF=Final volume after…
Q: Arrange the steps in the reaction catalyzed by threonine dehydrates in order, using the racemization…
A: Threonine dehydratase catalyzes the conversion of threonine to α-ketobutyrate , H2O and NH3 . The…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: draw the structures of the first dipeptides made in bacterial protein synthesis reactions when the…
A: The origin sequence is of 100 to 200 base pairs where replication fork begins. Specific proteins…
Q: ame: ear and Section: Laboratory Manual in Clinical Chemistry II 2023 Group no: Laboratory Report…
A: 1. The acceptable samples for measurement of Sodium and Potassium are typically blood samples, most…
Q: Draw the following Lipids in A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: A patient receives an intravenous (IV) solution that flows at the rate of 150 mL per hour. How…
A: The intravenous solution is the fluids or any medicine that is directly given into the vein. It…
Q: Time (s) 200 180 160 140 120 100 80 60 40 20 0 0 Change in absorbance vs Time 0.05 y = 660.47x…
A: Change in absorbance per minute at any wavelength can be determined by using the ratio of…
Q: Describe how will you dilute a 10X stock solution into 5X, 2X, and 1X, respectively.
A: INTRODUCTION : Diluting a Stock solution - A stock solution is a high or medium concentrated…
Step by step
Solved in 2 steps
- A typical bacterial DNA has a molar mass of 4 × 109 g m ol-1 . Approximately how many nucleotides does itcontain?Amino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are needed to codefor a protein with a molar mass of 5x10^5g/mol?1a) The phosphate groups in the sugar-phosphate backbone of each strand of a DNA molecule have a pKa of ~2.14. Normal physiological pH in most cells is 7.0-7.5, which is significantly above the pKa for the phosphate groups, so every phosphate group in the backbone of both strands of a DNA molecule is deprotonated and carries a -1 charge - but DNA in cells is normally double-stranded. Briefly explain, in your own words, why the large negative charges on the backbones of the two strands of a double-stranded DNA molecule don't cause the strands to separate under normal cellular conditions.
- Assume the energy of hydrogen bonds per base pair to be 5.86 kJ•mol-1. Given two complementary strands of DNA containing 145 base pairs each, calculate the ratio of two separate strands to hydrogen-bonded double helix in solution at 319 K. ratio = .283For the trinucleotide 5’ G-C-A-3’ How many nucleotide subunits are present in its ‘backbone’? How many nucleotide ‘non-backbone’ subunits are present? How many phosphodiester linkages are present? What is the overall charge carried by the trinucleotide?Polyglycine, a simple polypeptide, can form a helix with ϕ = -80°,Ψ= +150°. From the Ramachandran plot, describe thishelix with respect to handedness.
- The figure shows that the average distance between base pairs measured parallel to the axis of a DNA molecule is 3.4 Å. The average molar mass of a pair of nucleotides is 650 g•mol-1. Estimate the length in cm of a DNA molecule of molar mass 5.1x109 4.0 .26 g•mol-1. cm Roughly how many base pairs are contained in this molecule? [4.0 784615 x base pairs CG G C OH TA Thymine Adenine H. H. OH CH2 N-H.......O CH3 H H N……·H–N HLH TA OH 0-P H2C CG G C H. CH2 Guanine H OH Cytosine ... H-N TA AT H' N.....H-N HLH N-H.......O H2C OH H -o. -P3D0 TA 0- OH H. -CH2 (b) The most common structure of DNA, which is a right-handed double helix. The two strands are held together by hydrogen bonds (a) Base-pair formation between adenine (A) and thymine (T) and between cytosine (C) and guanine (G). and other intermolecular forces.if this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long. Calculate the length of the DNA assuming the molecular weight of a nucleotide pair is 600 Dalton and assume that the DNA is a B-form and that there are 10 base pair per turn which makes is 34 Å per turn. ( 1nm = 10Å)(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21
- CAN YOU PLEASE ANSWER 1b 1a) The phosphate groups in the sugar-phosphate backbone of each strand of a DNA molecule have a pKa of ~2.14. Normal physiological pH in most cells is 7.0-7.5, which is significantly above the pKa for the phosphate groups, so every phosphate group in the backbone of both strands of a DNA molecule is deprotonated and carries a -1 charge - but DNA in cells is normally double-stranded. Briefly explain, in your own words, why the large negative charges on the backbones of the two strands of a double-stranded DNA molecule don't cause the strands to separate under normal cellular conditions. 1b) If you raise the pH to 12, but keep everything else about the solution in which the double-stranded DNA is dissolved the same, the two strands of DNA will separate/the DNA will denature. Briefly explain, in your own words, why this happens - why does DNA denature at pH 12 but not at pH 7?A researcher isolates a new protein and finds that it contains 0.755% serine by weight upon amino acid analysis. The molecular mass of serine is 105 g.mol-¹. What is the minimum molecular mass for the protein assuming only one Ser residue per protein molecule? mmin = The researcher estimates the molecular mass of the protein using gel electrophoresis. From this estimated molecular mass, the researcher concludes the protein contains 3 Ser residues. What is the estimated molecular mass of the protein as shown by gel electrophoresis? g.mol-¹ mest = g.mol-1Avidin exists as a protein complex of around 68 kDa. Research to determine the types of interactions that hold the avidin complex together. Based on your research, which molecular weight would you expect for avidin when treated with beta-mercaptoethanol and run through a native gel? 35 kDa 68 kDa 10 kDa 19 kDa