OBJECTIVE & SCOPE OF THE PROJECT The scope of the project is to prediction of crops can be informed to agriculturists in time basis. Many Machine Learning techniques have been used to analyse the agriculture parameters. Some of the techniques in different aspects of agriculture are studied by a literature study. Blooming Neural networks, soft computing techniques plays significant part in providing recommendations. Considering the parameter like production and season, more personalized and relevant recommendations can be given to farmers which makes them to yield good volume of production. Q.CONVERT THE ABOVE SENTENCE'S WHERE OBJECTIVE SHOULD BE GIVEN AS POINTS AND EACH POINT SHOULD START WITH A VERB? O
Q: all of the following statements about mitochondrial oxidative phosphorylation are true EXCEPT a. The…
A: The metabolic pathway in which cells use enzymes to oxidize nutrients, releasing chemical energy and…
Q: Although as a whole, metabolic pathways are thermodynamically favorable, there’s at least one…
A: The Delta G of a reaction can be calculated as follows. Delta G = Delta G0 + RTln(Q) Where R =…
Q: I. ATP Calculation A. Given that three molecules of glucose underwent full oxidation, how many of…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Why could the acrolein test be used as a general test for all fats?
A: The qualitative analysis of lipids assists us in determining the presence or absence of lipids based…
Q: I. ATP Calculation A. Given that three molecules of glucose underwent full oxidation, how many of…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: why are fast acting neurotransmitters typically are small molecules?
A: Neurotransmitter is a signaling molecule secreted by neurons to affect another cell across a…
Q: ame: ear and Section: Laboratory Manual in Clinical Chemistry II 2023 Group no: Laboratory Report…
A: 1. The acceptable samples for measurement of Sodium and Potassium are typically blood samples, most…
Q: The location of enzymes is important for metabolic pathways. Which of the following enzymes is NOT…
A: Metabolic pathways require enzymes to catalyse their reactions. The pathways that occur in a…
Q: Give other chromatographic techniques that can be used for separating non-polar biomolecules, such…
A: Introduction: Chromatography is a method for separating a mixture in the laboratory. The mixture is…
Q: During lactic acid fermentation ___ is converted to ___ thereby oxidizing ___ a. Pyruvate ;lactate…
A: Pyruvate is the end product of glycolysis.NAD+ is needed for production of pyruvate. Under aerobic…
Q: Synthesized proteins are processed either inside the organelles or in the cytoplasm True False…
A: The proteins are constituted of twenty naturally occurring amino acids that are linked via peptide…
Q: Ammonia enters the urea cycle as: OA) aspartate. OB) glutamate. OC) carbamoyl phosphate. D) NH4*.
A: The urea cycle is the main metabolic pathway involved in the removal of nitrogenous waste that is…
Q: Draw the potential tautomers of guanine. Based on Question 1c) (i), label the patterns of hydrogen…
A: Guanine is a nucleotide base found in nucleic acids like DNA and RNA . It pairs with Cytosine with…
Q: Reabsorption of this substance involves carbonic anhydrase - inulin - bicarbonate - glucose -…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: 1. What constitutes the backbone of a nucleic acid? _ 2. Give the base sequence of the complementary…
A: Nucleic acids are organic molecules that act as the genetic material, and store and transfer genetic…
Q: what are the features which set the G protein family of receptors apart?
A: G protein-coupled receptors (GPCRs) are regarded as one of the most extensive families of validated…
Q: Question 20 Signal sequences are often found at the C-terminus of the polypeptide chain. True ●…
A: Proteins are polypeptide chains that are made up of amino acids. They are synthesised during…
Q: Can cytochrome a and a3 be put in complex I whereas cytochrome b and c1 are put in complex III?…
A: The redox potentials tell how an electron can be accepted or donated to a species. As a standard…
Q: 11. Calculate the equilibrium constant for the hydrolysis of glucose-1-phosphate at 25°C AG for the…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the rate of forward…
Q: Que Tuesday, December well Faudos *The amino acid alanine can be used as an energy source. alanine…
A: Alanine is a glucogenic amino acid, which synthesizes the precursor for glucose synthesis during its…
Q: The first step in glycogenolysis (or the catabolism of glycogen) is the formation of: O A)…
A: Glycogenolysis is the process of breaking down of glycogen to glucose. It is a catabolic pathway.
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: Consider the equilibrium of arginine below: NH₂ NH₂ H₂N: 0 NH OH H₂NE pKa-2.17 NH3 NH H₂N: pKa 9.04…
A: The proteins are constituted of 20 naturally occurring amino acids. The net charge on an amino acid…
Q: Choose the correct path taken by a pair of electrons as they travel down the electron-transport…
A: Electron transport chain consists of a group of protein complexes in the mitochondrial membrane…
Q: Fatty acids released by hormone sensitive lipase in adipocytes are transported to muscle by: OA)…
A: The adipose tissue stores surplus nutrients in the form of neutral lipids in the body that in turn…
Q: Given the lipid structure below, part A was derived from __________ while part B was derived…
A: Glycerophospholipids have a structure similar to triacylglycerides, except that they are polar. They…
Q: 2. Please give the occurrence of Isoflavone s? What is the different between Isoflavone s and…
A: In order to minimise the risk of serious chronic diseases, phytochemicals—which are classified as…
Q: 2. Look at the diagrams below and indicated if the evidence came from the victim or suspect in…
A: DNA carries genetic information in most of the cells. DNA is a type of nucleic acid which has a…
Q: Enzymes are essential to the processes of photosynthesis and cellular respiration. Names two factors…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Consider a defect in MIG12 that prevents the binding of this protein to acetyl-CoA carboxylase. How…
A: Introduction: Acetyl carboxylase is a multifunctional enzyme that contains three functional domains…
Q: Suppose you want to test the results of a transformation by growing E. coli cells in LB medium…
A: Equation of dilution: M1V1 = M2V2where: M1 is the molar concentration of the stock solution. M2 is…
Q: Nadph is primarily produced in the ___ through the ___ process. it is consumed during ___ a.…
A: After glucose enters a cell, it is immediately converted to glucose 6-phosphate. Glucose 6 phosphate…
Q: Meselson-Stahl Experiment showed that DNA replication is semi-conservative. In the experiment, DNA…
A: The Meselson-Stahl experiment proved that DNA replication is semiconservative. For the experiment,…
Q: SEMINAR TOPIC Role of oxidative stress in the pathogenesis and complications of diabetes
A: Oxidative stress is caused by disparity between production and accumulation of oxygen reactive…
Q: Place the stages of sleep in the order they will typically happen. 1234 The stage between…
A: Introduction:- The question is about the sleep cycle where there are various stages occurs before…
Q: TRUE OR FALSE 1. Carboxybiotin is covalently linked to an enzyme via E- amino group of a lysine…
A: An enzyme is a substance that acts as a catalyst in the living systems. It increases the rate of…
Q: explain the following prperties of G protein: structure of G- activation cycle and signaling pathway…
A: G proteins are the Guanine nucleotide binding proteins which functions in transducing signals…
Q: Why can physostigmine, an AchE blocker, be used to treat myasthenia gravis? OA. Physostigmine blocks…
A: Myasthenia gravis is an autoimmune disorder. In this disorder there is muscle weakness due to…
Q: Is B monomer a beta fructose or alpha fructose. How do you know?
A: Cyclization of linear fructose can give us a furanose ring. Furanose is 5 membered ring . The 5…
Q: A) Polymer Lipid DNA B) Monomer (or component units in the case of lipids). Draw the specific…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: TRUE OR FALSE 1. Rotational entropy is the freedom to move in three-dimensions. 2. Vitamin B1…
A: In the cellular environment, the condition do not allow biochemical reactions to occur at…
Q: Discuss how the shuttle mechanisms for cytoplasmic NADH operate in eukaryotes.
A: Most textbooks mention that under aerobic conditions, NAD+ is regenerated in the ETC. But the…
Q: A genetically modified bacterium was cultivated to produce 1,3-propanediol (1,3-PDO), and the…
A: Oxygen Demand is a measure of the amount of oxidizable substances in a water sample that can lower…
Q: In determining the activity of an enzyme of choice, which do you prefer, monitoring the product…
A: Enzymes are biological catalysts that enhance biochemical reactions in living organisms. The…
Q: In the folded protein, His108 forms a salt bridge with Asp44. The pKa of the imidazole functional…
A: pKa is the pH at which a weak acid is 50% dissociated into H+ and conjugate base. Also, pKa = -log…
Q: Draw the structure of the a-keto acid formed by the transamination of each amino acid: (a) tyrosine…
A: Transamination is a type of reaction in which, the amino group of an amino acid is transferred as a…
Q: what is bioenergetics ?
A: The scientific field of biochemistry focuses on all the chemical and biological processes involved…
Q: Which of the following is not a characteristic of DNA replication? O The synthesis of DNA is…
A: DNA carries all the genetic information needed to make an organism. DNA contains genes which are the…
Q: Draw the L(leucine)-A(alanine)-E(glutamate) triple tide and calculate its isoelectric point.
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: 1. What are buffers? 2. Using the pH scale, describe how you can indicate if the blood solution is…
A: Buffers are chemical systems which allows a solution to have a stable pH. Most buffers can help…
Step by step
Solved in 2 steps
- irections: Answers must be in essay form. Outline form is not acceptable. Labeled diagrams may be used to supplement discussion, but in no case will a diagram alone suffice. It is important that you read each question completely before you begin. An agricultural biologist was evaluating two newly developed varieties of wheat as potential crops. In an experiment, Seedings were germinated on moist paper towels at 20°C for 48 hours. Oxygen consumption of the two-day-old seedlings was measured at different temperatures. The data are shown in the graph below. CUMULATIVE OXYGEN CONSUMPTION O Variety A 7"C - Variety A 17e O Variety B 7°C • Variety B 17°C 20 40 Time (min) 60 8. In a second experiment, variety A seedlings at both temperatures were treated with a chemical that prevents NADH from being oxidized to NAD*. Predict he most likely effect of the chemical on metabolism and oxygen consumption of the treated seedlings. Explain your prediction. v + , N - C (qu) Oxygen ConsumptionIdentify one environmental problem. Diagram all the fields of specialization needed and state research questions they need to answer in proposing a solution to that problem. A sample diagram is attach for your guidanceCompare and contrast between lowland (rice) and upland crops (choose one among coconut, mango, banana, corn, soybean, or sweet potato) in terms of (1)land preparation (2) procedure, and (3) objectives.
- What are your insights and lessons learned from the purpose and function of Agricultural Extension as well as the agencies involved in it? Why does agricultural extension promote sustainable development and sustainable agriculutre? What are its challenges and how is it impportant in our world today? What does agriultural extension as intervention in sustainable developent mean and how does various methods influence human behavior towards change?What are the new innovations in Agriculture Sector that an ABE graduate may directly or indirectly contribute their knowledge, skills or ideas? (List at least 2 in each Field of Specialization listed below: 1. Farm Power and Machinery 2. Farm Buildings and Structure 3. Farm Electrification and Processing 4. Soil and Water Conservation)Discuss in detail: What are the top 10 Indian agricultural insects that cause heavy loss and also include the controlling Mechanism with research articles. Kindly mention the articles (I need it importantly). Thanks in advance. It is not an essay or graded question.
- Describe and assess several ways in which high-inputindustrial agriculture can be beneficial for the environmentand several ways in which it can be detrimental.Now suggest several ways in which we might modifyindustrial agriculture to reduce its environmentalimpacts.Purpose: To determine the effect of varying fertilizer brands upon the growth rate of a vinca plant. What are the independent and dependent variables in this experiment?Review A farmer wishes to develop a strain of high-yield corm that is also resistant to drought. He has the following individuals from the current year's crop: Individual A-Yield: 179 bushels/acre; drought resistance: high Individual B-Yield: 220 bushels/acre; drought resistance: low Individual C-Yield: 185 bushels/acre; drought resistance: medium Individual D-Yield: 140 bushels/acre; drought resistance: high Individual E-Yield: 200 bushels/acre; drought resistance: medium Which of the following crosses would produce the highest corn yield with the highest resistance to drought? v View Available Hint(s) Hint 1. Determine the average yield and drought resistance expected from each cross. B and B A and B C and E A and E Submit Request Answer (P Pearson O O O O
- Situation: A student is planning to conduct a research related to the effects of pulverized mango rind on the growth of tomato plants. Specify the dependent, independent and controlled variables in the given situation abovearticle: Experimental addition of marine-derived nutrients affects wildflower traits in a coastal meta-ecosystem 1. From the study what two variables are being linked? 2. What is the main variable of the study that has plentiful effect on the surrounding habitat? 3. What/How the experiments (comparing to what....) are being conducted and to what objective/s? 4. What is the significance of the paper in relation to community ecology?Please make detailed connections to the future use of the sunflower plant and the both the potential positives and negatives