Part B/D? Part C1. Glu-Ala-Phe2. Val-Val-Arg3. Val-Met-LysVal-Val-Arg-Val-Met-Lys-Glu-Ala-PheSubmit Previous Answers✓ CorrectPart DWhat further experiment should be carried out in order to determine the primary structure of the polypeptide?The two possible primary structures can be distinguished by carboxypeptidase A.The two possible primary structures can be distinguished by Edman 's reagent.The two possible primary structures can be distinguished by treatment with cyanogen bromide.Submit Request Answer Three peptides were obtained from a trypsin digestion of two different polypeptides. In each case, indicate the possible sequences from the given data.Part A1. Leu-lle-Lys2. Phe-Pro-Val-Arg3. Ala-Val-GluLeu-lle-Lys-Phe-Pro-Val-Arg-Ala-Val-GluSubmitPrevious Answers✓ CorrectPart BWhat further experiment should be carried out in order to determine the primary structure of the polypeptide?The two possible primary structures can be distinguished by carboxypeptidase A.The two possible primary structures can be distinguished by Edman 's reagent.The two possible primary structures can be distinguished by treatment with cyanogen bromide.Submit Request Answer

Introduction Protein is the most abundant macromolecule in our body. Amino acids are the building…

Answered: ✓ Part B What further experiment should…

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 15QP

See similar textbooks

Similar questions

Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-Arg
A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin, and the other with cyanogen bromide. Given the following sequences of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment: Asn-Thr-Trp-Met-Ile-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen Bromide treatment: Gln-Phe Ile-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met
A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptide
Identify the primary sequence for the polypeptide that yields these fragments upon treatment: His-met-thr-met-ala-trp; Leu-asn-asp-phe; Val-lys obtained from chymotrypsin Leu-asn-asp-phe-his-met; Ala-trp-val-lys; Thr-met obtained from CNBR
Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)
A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C- terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-
5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13
Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are present after the protein is treated with Trypsin? Ala-Leu-Arg-Gly-Met-Val-Arg-Lys-Ala O 2 6. 8.
The following steps were performed using enzyme cleavage of a peptide to determine its amino acid sequence. Step 1. FDNB yield DNB-Gly Step 2. Treatment with trypsin yield 3 fragments: Tyr-Leu-Asp-Arg; Gly-Ser-Ala-Lys; Trp-Gly-Ser-Met Step 3. Treatment with pepsin gave the same 3 peptide fragments. What is the sequence of the peptide?
Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were as follows: Trp-Arg-Thr-Gin Ser-Trp-Arg-His-Trp-Ala-Lys Asp-Val-Ala-Ala-Lys Asn-Ser-Asn-Val-Ile-Arg The sequences of the smaller peptides produced by chymotrypsin digestion were as follows: Arg-His-Trp Arg-Thr-Gin Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp The original peptide sequence was: Asp-Val-Ala-Ala-Lys-Ser-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-His-Trp-Arg-Thr-Gin Asp-Val-Ala-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin-Ser-Trp-Arg-His-Trp-Ala-Lys Trp-Arg-Thr-Gin-Asn-Ser-Asn-Val-Ile-Arg-Ser-Trp-Arg-His-Trp-Ala-Lys-Asp-Val-Ala-Ala-Lys Arg-His-Trp-Arg-Thr-Gln-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Asp-Val-Ala-Ala-Lys-Ser-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp-Arg-His-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin…

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning