The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is the codir strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation. Mutation DNA Sequence None 5' ..А T GGCG C ТGTG GAGCT АА.. 3' A 5' ..A T G A C G C T GTG GAG C T A A.. 3' В 5' ..A T G G C G C T GTGA AG C T A A.. 3' C 5' ..А T GGCG C тстG GA GCT АА.. 3' The region without a mutation is transcribed, and then translated. Give the protein that is translated from this section of DNA. the single letter abbriviations for amino acids with no spaces.
Q: DNA sequence
A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…
Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…
A: The introns are the non-coding parts of the premature mRNA that must be removed by…
Q: The length of the SURF1 gene is 15, 914 bases. This gene is comprised of 11 exons and 10 introns.…
A: Ans. The gene has specific sequences which are important for the transcription of the gene. One of…
Q: If a mutation deletes the start codon in a eukrayotic gene, which of the following most accurately…
A: The start codon is a three-nucleotide long sequence in a gene that is responsible for the initiation…
Q: The length of the SURF1 gene is 15, 914 bases. This gene is comprised of 11 exons and 10 introns.…
A: In the diagram shown SURF1 gene. SURF1 gene is present at 9th chromosome & produces surf…
Q: Which is true about eukaryotic cDNA? Choose all that apply. a. it is constructed from mRNA that…
A: Complementary DNA (cDNA) is made from messenger RNA in the laboratory for various purposes. Because…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: The central dogma of life can be stated as follows: Replication of DNA to form new copies of DNA…
Q: Two eukaryotic proteins have one domain in common but areotherwise very different. Which of the…
A: Eukaryotes are organisms whose cells have a nucleus enclosed within a nuclear envelope. Eukaryotes…
Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…
A: Transcription is process through which DNA is converted into mRNA.
Q: A molecular geneticist hopes to find a Gene in human liver cell that codes for an important…
A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: With the help of the Human Genome Project, it has now become possible to sequence all of the genes…
Q: If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the…
A: Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…
Q: The coding strand of a mutant gene A allele is shown below. On the space provided, type the…
A: The translated product of mutant gene will contain the amino acid synthesized from the transcribed…
Q: A small section of bacterial DNA template (anti-sense) strand has the following nucleotide…
A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur…
Q: Match up the DNA mutation with its description: Silent a. a point mutation where one amino acid is…
A: Silent - g) a point mutation where the amino acid sequence are unchanged Missense mutation - a) a…
Q: A given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding…
A: Since we know in RNA Thymine is replaced by Uracil. So Adenine is binded to Uracil. This forms the…
Q: Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’…
A: Gene is the basic unit of heredity. All living organisms contain nucleic acid in their nucleus as…
Q: Which type of mutation would expect would have no effect on a protein coding gene in eukaryotes?…
A: “Silent” mutation: doesn't change an amino acid, however in some cases will still have a…
Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…
A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…
Q: Which of the following describes the effect of a frameshift mutations? * A. all mRNA codons change…
A: Cental dogma is the process via which DNA is transcribed into mRNA then the mRNA is translated to…
Q: Which of the following mutations is potentially the most harmful? O A) base-pair substitution at the…
A: Introduction: Mutation refers to the alterations that occur in the DNA sequence. They are found to…
Q: a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…
A: Transcription is a process in which a DNA strand is transcribed into mRNA by an RNA polymerase…
Q: Which of the following describes the most likely effect that a single base substitution in the…
A: Point mutation It is a type of genetic mutation in which a single nucleotide base gets altered,…
Q: Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic…
A: Single base pair mutation in mRNA transcript in Eukaryotes is less serious because mRNA of Eukarotes…
Q: Original strand: G G G C T A G G G C C A A , Mutant strand: G G G G C T A G G G C C A A . What type…
A: According to our guideline we can answer only the first three subparts of a question. So, please…
Q: Which of the following is TRUE regarding reading frame? O a) An open reading frame can have many…
A: Answer: Introduction: A reading frame is an order of nucleotide triplets which signifies amino…
Q: Consider the following gene with their respective introns and exons 5’ –…
A: Since you have asked multiple questions, we will solve the first three question for you. If you want…
Q: You want to examine genetic variation in your gene promoter. You sequence DNA from several…
A: Single nucleotide polymorphism; it is a type of genetic variation which can occur throughout a…
Q: Shown below is a nucleotide sequence alignment consisting of corresponding sequences of the same…
A: A change in the normal specific DNA sequence that can arise due to the anomaly is DNA replication or…
Q: A codon is supposed to be 5'-UGG-3', but a mutation causes it be 5'-UAG-3'. Which one of the…
A: Mutations are sudden changes in the genetic material. Mutations are heritable. Mutations are random.…
Q: 1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: C G T G T G GAGCT A A.. 3' 5'..A TG GCG CTGTGA AGC TA A.. 3' 5 . .A TGG CGCT CTG GAGCTA A.. 3' on…
A: Mutations of the spontaneous change in the DNA molecule. Synonyms mutations does not change the…
Q: Part of the protein-coding region in a gene has the base sequence 3-…
A: Gene Gene is the part of DNA which code for polypeptide chain.
Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…
A: DNA stands fo deoxyribonucleic acid. It is the genetic material.
Q: If a mutation occurs in a coding region a. it will cause a change or changes in the normal…
A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…
Q: Could a frameshift mutation result in the production of a larger than wild type protein?
A: Frameshift mutation occurs due to deletion or addition if nucleotides which produces non functional…
Q: Which of the following is the definition of a gene? A. RNA that delivers amino acids to a ribosome…
A: Genetics is a science of the study of genes. It involves the identification of specific genes for…
Q: You see partial sequence of a gene as follows (non template strand shown)…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript…
A: The mRNA is produced by the process of transcription.
Q: In the table below, there are four versions of gene A, one of which is normal, and the other three…
A: Mutations are sudden heritable changes that change gene expression. These changes in gene expression…
Q: The coding sequences of Gene Fand Gene G are shown by the double-stranded DNA below: Gene F 5'…
A: The process of making a copy of an RNA sequence from a gene sequence is called transcription. The…
Q: In a study of several families for differences in the sequence of a particular gene suspected to…
A: The mutation is the change in the nucleic acid sequence that alters the way the particular gene gets…
Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr.…
A: The DNA (deoxyribonucleic acid) codes for the peptide chain via transcription and translation. mRNA…
Q: Which of the following would probably cause the most severe damage to a gene's expression and…
A: A phenotype is expressed by a gene by the process of transcription of the gene from DNA to make an…
Q: An individual with the genetic condition cystic fibrosis has CFTR protein with the amino acid…
A: There are many different types of mutations in CFTR protein that can cause cystic fibrosis. Most…
Q: Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this…
A: Messenger (mRNA) ribonucleic acid helps in the formation of protein as it contains the long base…
Q: Examine the following sashimi plot from a transcriptomics experiment. The red peaks mostly RNA STAR…
A: Despite of immense growth in science and technology of sequencing of RNA and DNA, it was challenging…
Q: B. At a position immediately following the fifteenth codon of a protein coding region, five base…
A: Mutations ate the abrupt changes in the DNA sequences that changes the amino acid it codes for.
can someone answer this for me please?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationThe following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is the coding strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation. Mutation DNA Sequence None 5' ..A TGGGCGAGGT ATTATA G.. 3 5' ..A TGGGCGAGAT AT TA TA G.. 3' 5' ..A TGGGCGAG GTA CTATA G.. 3' C 5'..A TG GCCGAGG TATTATA G.. 3' The region without a mutation is transcribed, and then translated. Give the protein that is translated from this section of DNA. Use the single letter abbriviations for amino acids with no spaces. N- -C Determine the molecular basis for each mutation and what effect there would on the protein. Mutation Molecular Basis Effect on ProteinBased on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’
- Given Sequence: 3’-TACGGTCCGGATTCGGTAGCTAGCATC-5’ Provide: Complementary Strand: Transcript Amino Acid Sequence 2.Given Sequence: 5’-GGGCATATGCCGTTTACCGGTTTGACTAAATAACCA-3’ Provide: Complementary Strand: Transcript Amino Acid Sequence 3.Given Sequence: 3’-AAC CAA TAC GTG AGG ATA CCA AGT AAC ACT CCC-5’ Provide: Complementary Strand: Direct Transcript: Transcript for Translation: Amino Acid Sequence:O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) Lactose Lactose No Lactose Genotype PP0 Z Y/I P*O*Z•Y* I'POCZ Y*/I P* O©Z*Y° P O Z'Y/I P'OʻZ'Y* PP O ZY*/IP*O*Z*Y* IP OCZ Y /I P*O*Z•Y* IPO ZY*/I* P*O©Z*Y• I'PO*Z Y*/IP'O*Z*Y°1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutation? Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA OC. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUA
- Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5 TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5 46 77 90 5' AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 110 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5' 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3 ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. (i) Identify both the hexameric sequences of the promoter region in the coding strand above.Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5' TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5' 46 5 AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5 77 90 110 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3' ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. Illustrate how termination of transcription occurs in the gene above. (Hint: position from 156 to 180)Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?
- EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 1 EboV Strain 1 (Circle the mutated bases) CCA TGT AAG TGG TTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 2 EboV Strain 2 (Circle the mutated bases) TCA TGT CAG CAA CTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to 330. Transcription starts at the Transcription Start Site (TSS) that is the base located at position 57. -55 5' AATAAСTTGAGATTTTGATTGACАТССТТСТСАCAGAGCCTATAATACCТАТТТС 3' 3'TТАТTGAACTСТААААСТААСТGTAGCAACAGTGTCТСGGATATTATGGATAAAG 5' 56- 5' ТACGTATAGAСАСТСAGAGGAAAGACAGAGAGAGAGTTAGCATTGTACTАТСТСТ 3' 3' АTGCATATСТсTGAGTCTCCTTтстстстстстсТСААТСGTAACATGATAGAGA 5' 65- -105 --110 -140- 5' СТTTTAGATATATCTCТАТСТСТСТСАСТССАТСТТТСТCGTGTTAACACAAСА 3' 3' GAAAATCTATАTAGAGATAGAGAGAAGTGAGGTAGAAAGAGCACAAТТСTСТTGT 5' 111- -120- -130- -150- -160----165 166- --175- --185- -195 -205- -215-----220 ------- 5' GTCACAGACTCACAGATCTTTGTCGGTGATCGGAGATGGAGTTCCGGGAGAAGCT 3' 3' CAGTGTCTGAGTGTCТAGAAACAGCCACTАGССТСТАССТСААGGCCCTСТТCGA 5' 221- -230- 240 -250 -260 -270-----275 5' TTATAAGTTCAAGTTGCAATAGGTGTTTGCCTTTGTTTTATCTCTCCTCACCGTA 3' 3'ААТАТТСААGTTCAACGTTATCCАCAAACGGAAACAAAАТAGAGAGGAGTGGCAT 5' 276- -285- -295- -305 -315…