Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence).    Wild Type:      5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1:         5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2:         5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3:         5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4:         5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5:         5’ ATG GCT AGA ATC GAG GTT 3’

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: The DNA sequence within the transcription unit of a gene is shown below. Important sequences are…

A: Transcription is the process which is responsible for making mRNA from the DNA by the action of RNA…

Q: The recognition sequence for the restriction enzyme TaqI is T↓CGA. Indicate the products of the…

A: Restriction enzyme is a protein that recognizes a specific, short nucleotide sequence and cuts the…

Q: Consider the following chart: What type of mutation is this? DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC…

A: By the translation process polypeptide chain is being synthesized from the mRNA sequence by the help…

Q: What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'?…

A: As per our guidelines we are supposed to answer only 3 sub parts.

Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…

A: Given sequence of EboV strain 1 is CTA TGC AAG CAG TTA and strian 2 is TCA TGT CAG CAA CTA.

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: According to the question, we have to answer the question that which is for the chromatograph below,…

Q: Normal DNA:     TGC GTG CTT  AAG CGG TGT  ACA CGT  TGC  mRNA: Animo Acid: 1st Mutation TGC GTG…

A: Mutations are sudden irreversible changes in the DNA sequence that arise due to ionizing radiations,…

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: Given the following genotypes, explain, by answering the questions in each number, how the mutation…

A: i + p + o + z - y + Complete set of gene products will not be there because z gene that codes for…

Q: A small section of bacterial DNA template  (anti-sense) strand has the following nucleotide…

A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur…

Q: 3' c |c 5' 5' 1 1 1 A T 2 2 2 A C c 3 3 3 G T 4 4 4 A Reference - DMD - Template 5 6 T C c G…

A: Coding strand    Coding strand is-       GGT AAT GGC  AAT  AGA  GGC  CGA  TAC  ACA  GGA patients…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: The following sequence is a mutant version of the above gene that is present in a mutant bacterial…

A: As required, only E and F has been answered.

Q: Which of the following terms refer to the case when a mutation results in a partial loss of the…

A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while copying…

Q: CHOICES: Isoniazid Rifampicin Ethambutol None of the Choices Causes more adverse effects to…

A: The correct option is Rifampicin. Rifampicin: • Causes optic neuritis. Explanation-…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: DNA is a nucleic acid formed of two strands of nucleotides. The nucleotides have nitrogen bases that…

Q: CUGACUGACUGA A template strand of DNA in a gene reads: TGG CTG GGT GCT ACA. GUCAGUCAGUCA Using the…

A: Firstly DNA template strand undergoes transcription process to form RNA. After that translation…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia (AML) is a kind of blood cancer.

Q: Given the template DNA sequence:  3’ - TAC - CAG - GTT - ACC - ATC - 5’    A.) What will be the…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: In the chapter-opening photograph of kernels on an earof corn, what is the genetic basis of the…

A: Part a.The fully pigmented kernel has resulted from the wild-type copy of the C gene expressed in…

Q: Put these events in chronological order and explain why (i.e. each process listed).   Sigma factor…

A: Transcription is a process of formation of mRNA from DNA. This process is done with the help of RNA…

Q: The following is a polypeptide from a wild type organism: met – ser – tyr – his – trp – arg – ser –…

A: Mutation is any sudden change resulting in an abnormal structure.  The given polypeptide chain is,…

Q: Use the (non-template) DNA strand below to determine which is the promoter/sigma binding region:…

A: Introduction: A promoter is a DNA sequence to which proteins bind to start transcription of a single…

Q: Shown below is a nucleotide sequence alignment consisting of corresponding sequences of the same…

A: A change in the normal specific DNA sequence that can arise due to the anomaly is DNA replication or…

Q: Identify the following mutations and describe what the possible effect on the protein will be. (4)…

A: Mutation in general refers to the change in one or more gene. Some are negligible while others can…

Q: What type of mutation is depicted by the following sequences (shown as mRNA)?Wild type ....5′…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the usual…

Q: Identify the type of point mutation on the following strands (transition or transversion):  a. 5’…

A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…

Q: A mutation in which of the following would still allow RNA polymerase to bind to promoters but would…

A: To start transcribing a gene, RNA polymerase binds to the promoter region of the gene's DNA. It has…

Q: A double mutant produced by uneven crossing-over contains two single nucleotide mutations that…

A: The mRNA or messenger RNA contain the genetic codon that are translated into polypeptide chain by…

Q: The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′…

A: The mutant gene produces when there are changes in the sequence of nucleotides in the wild type…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: Mutations in the DNA molecule are caused by a spontaneous alteration. After a synonym mutation, the…

Q: ive the SIGNIFICANT difference between the terms provided in the table below.

A: Somatic Mutation   Germline Mutation     It occurs in the non-germline cells i.e. except…

Q: Select the best technique to answer the following question: Where does the transcription factor…

A: The Nanog protein activator for the Rex-1 promoter by positive feedback mechanism and it's playing a…

Q: Lgh ndrome is a metabolic disorder that affects the cetral nervous system a mutation in the MT-ATP6…

A: Proteins are synthesized from mRNAs through translation. mRNAs are synthesized through…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAA…

A: DNA is formed of four types of nitrogenous bases, which are adenine, thymine, guanine, and cytocine.…

Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…

A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…

Q: AZT (3'-azido-2',3'-dideoxythymidine) is a drug for HIV infection that gets incorporated into…

A: HIV is a retrovirus. Hence inorder for it to multiply inside the host , it first has to synthesize…

Q: Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of…

A: Restriction enzymes are those that cleave the double stranded DNA at specific site. They have…

Q: In the table below, there are four versions of gene A, one of which is normal, and the other three…

A: Mutations are sudden heritable changes that change gene expression. These changes in gene expression…

Q: For the given mutation below,please write down the reverse mutation and any intragenic suppressor…

A: Reverse mutation It is the mutation which denotes the mutational process that restores the wild type…

Q: DNA 1RNA MRNA AA Sequences GGC CIG GTT AAA TGG CCG GAC CAA T ACC GGC CTG GTT AAA TGG GLY LEU VAL LYS…

A: The base pairing of DNA and RNA differ slightly in their nucleotide bases. DNA uses the bases…

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr.…

A: The DNA (deoxyribonucleic acid) codes for the peptide chain via transcription and translation. mRNA…

Q: A template strand of DNA in a gene reads: CCA AGC TCT. Using the codon chart provided, what is the…

A: Translation:  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: An individual with the genetic condition cystic fibrosis has CFTR protein with the amino acid…

A: There are many different types of mutations in CFTR protein that can cause cystic fibrosis.  Most…

Q: Describe the following a. Core enzyme RNA polymerase b. Sigma factor c. Promoter consensus sequence…

A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.