PO mod 5' 787 18 32 806 789 bases P3 mod P5 3' 1542 1507 1487 721 bases FIG. 1. Diagram of locations of primers on Escherichia coli 16S rDNA, an open reading frame that is 1,542 bases long. The locations of the modified priming sites used for the PCR are shown. Pomod primes at site PO with an extension going to the right. P3mod primes at site P3 with the reaction going to the right; PC3mod primes at the same site with the reaction going to the left. PC5 primes at site P5 with the reaction going to the left. The designations 5' and 3' and base numbering refer to the sense strand.

PO mod 5' 787 18 32 806 789 bases P3 mod P5 3' 1542 1507 1487 721 bases FIG. 1. Diagram of locations of primers on Escherichia coli 16S rDNA, an open reading frame that is 1,542 bases long. The locations of the modified priming sites used for the PCR are shown. Pomod primes at site PO with an extension going to the right. P3mod primes at site P3 with the reaction going to the right; PC3mod primes at the same site with the reaction going to the left. PC5 primes at site P5 with the reaction going to the left. The designations 5' and 3' and base numbering refer to the sense strand.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section18.1: Key Dna Technologies For Making Genetically Altered Organisms

Problem 2SB

See similar textbooks

Similar questions

The restricition EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3' the restriction enzyme Hindll cleaves at the sequence 5'-AAGCTT-3'. A 20 kb circular plasmid containing OFP gene is digested with each enzyme individually and then in combination, and the resulting fragment sizes are determined using electrophoresis Restriction Enzyme(s) ECORI alone Fragment length 6 kb ,14 kb 7 kb , 13 kb 2kb, 4kb, 5 kb, 9kb Hindlll alone EcoRI and Hindll Construct the circular molecule and indicate the relative positions of the EcoRI and Hindlll restriction sites
The short sequence shown below is part of a gene of interest. You decide to amplify this part of the gene by PCR. One primer has been provided by your lab supervisor as shown 3 GAGAGC 51 5'TGAGCAGCGATGCCGATGTTGCCAATGCAGCTCTCG-3'| Which of following additional primers would you need to make? OA S'ACTGCT'3 OB. S'ACGAGT3 OC. SUGAGCA'S D. STGAGCA'3
1. Briefly explain why the total size of the pMBBS plasmid in the Restriction Enzymes practical is 3000bp (base pairs) 2. Briefly explain why the cut sites on the pMBBS plasmid in each Restriction Enzymes (EcoRI, BamHI, and XhoI) just 1 each 3. Briefly explain what led to the 5 fragments formed which linked to the 500bp, 1000bp, 1500bp, 2000bp, 2500bp sizes
Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is inserted in to the polylinker site of pUC18 and then introduced into E. coli cells.. Hindll Sphl Sbfl Pstl BspMI Acci Hincli Sall Xbal BamHI Aval Smal Xmal Acc651 Kpnl Banll Eco53kl Sacl Apol ECORI lacz MCS LacR binding site Plac PUC18 Amp 2686 bps PMB1 ori
For this activity you will draw out the first steps of the PCR reaction, using the following as a short template. Take a picture of your drawing and upload it to this Question. 5' TTGCGTACGTGCATGTGTGCACATATGTCC 3' 3' AACGCATGCACGTACACACGTGTATACAGG 5° In your upload submission be sure to include: 1. Label the 5' and 3' end of the template and each primer, and indicate the direction in which polymerization will take place. 2. Write the sequence of a 10 base pair Forward primer and a 10 base pair Reverse primer binding to the template strand. Add an arrow showing which direction polymerization will take place 3. Add a DNA polymerase to the drawing above showing where the polymerase will bind. 3. Draw and label a DNTP nucleotide. Show how this monomer gets incorporated into a new DNA strand?
An optimum ligation reaction should contain approximately 50 ng of vector. Given yourconcentrations recorded below, what is the volume of vector that should be added to eachligation reaction to have this mass of DNA in the reaction? Size of asPink-promoterless in bp: 702 (vector) Size of pCusC in bp: 157 The concentration of digested & purified PCR insert: 13.849 The concentration of digested and purified plasmid: 6.887 Any help with this is appreciated. I'm a bit confused thx
1) The DNA fragment shown in Figure 1 is cleaved by the restriction enzyme EcoRI as indicated. The number in parenthesis shows the position of the cleavage site. The total length of the DNA fragment is 4000 bp. Small parts of the DNA sequence is known as shown. 5' ACCCTAGGTGTGACCGCGATCCGGCAGCATAAT 3' EcoRI (400) EcoRI (1300) EcoRI (3800) 3' CGCGAAATGCTTTAAGCGCTCTACGGGAGGG5' 3'AGCGTTAGAGTAGCCGGTAAAGGGTACGCGCCTTAA 5' Figure 1: DNA fragment with a total length of 4000 bp. The figure below depicts a gel on which marker DNA of known size has been run. Sketch the location of the bands that will appear, if the DNA fragment shown in Figure 1 is cleaved by EcoRI and afterwards run on the gel along with the marker DNA. 6000 5000 4000 3000 2000 1000 800 600 500 400 200
Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product which is cloned into a 1.5 kb plasmid for bacterial expression. What would the agarose gel look like, including a lane for markers, and where would the following pieces of DNA run: 1. the PCR insert 2. the empty uncut plasmid 3. the empty plasmid cut with a single restriction enzyme 4. the cloned plasmid containing the insert
Alu 1 EcoRI ori pKY Bgl I Tet: Tetracycline resistance gene A. What would be the donor organism to be used in this cloning? B. How would you make sure you only get your gene of interest (EGF) from donor but nothing else? C. How do you put EGF gene into pKY plasmid? What is the best RE to use when inserting the gene into pKY plasmid? What happens if you use the enzyme Bgl I to insert the gene of interest? How does it affect your cloning result? D. How do you make sure you only grow E.coli that have the gene of interest?
PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |
Single stranded DNA fragment of M13 phage DNA shown was mixed with the following primers P1: AGTAG AATTGATGCC ACCTT; P2: TGT CTG GAA GTT TCA TTC CA and incubated in a thermal cycler in the presence of the four dNTPs and Taq DNA polymerase under the PCR conditions.AATGCTACTA CTATTAGTAG AATTGATGCC ACCTTTTCAG CTCGCGCCCC ATAGCTAAAC AGGTTATTGA CCATTTGCGA AATGTATCTA ATGGTCAAAC CGTTCGCAGA ATTGGGAATC AACTGTTACA TGGAATGAAA CTTCCAGACA What is the length of the PCR product? What is the final concentration of PCR product after 10 cycles if the starting template concentration was 1 nM?