The restricition EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3' the restriction enzyme Hindll cleaves at the sequence 5'-AAGCTT-3'. A 20 kb circular plasmid containing OFP gene is digested with each enzyme individually and then in combination, and the resulting fragment sizes are determined using electrophoresis Restriction Enzyme(s) ECORI alone Fragment length 6 kb ,14 kb 7 kb , 13 kb 2kb, 4kb, 5 kb, 9kb Hindlll alone EcoRI and Hindll Construct the circular molecule and indicate the relative positions of the EcoRI and Hindlll restriction sites

Q: What will be the sizes of the 2 restriction fragments if NO insert is present in pUC19?

A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…

Q: In the following "gene library" cloning experiment. Digested genomic DNA AmpR gene TCR gene TCR is…

A: Please follow step 2 for detailed explanation.

Q: You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…

A: Restriction enzymes are molecules that cleave nucleic acid (DNA) at a specific sequence. Restriction…

Q: The plasmid PSU922 is a circular DNA containing 25000 base pairs. The B-gal gene codes for the…

A: Restriction endonucleases, often known as restriction enzymes, are found in all prokaryotes. The…

Q: Restriction endonucleases (RE) are one of the most used enzymes in biotechnology for recombinant DNA…

A: Restriction enzymes are the enzymes which cut DNA sequences at a particular site. Restriction enzyme…

Q: The table below shows restriction enzyme pairs used by various teams to digest the YFG and clone it…

A:

Q: A result of agarose gel electrophoresis of plasmid DNA is shown below. The direction of the…

A: When we isolate the plasmid it can be in relaxed, nicked or supercoiled forms. The supercoiled form…

Q: Draw a representative agarose gel showing the bands, and the direction of current flow as well point…

A: EcoR1 is a restriction enzyme that can cleave a dsDNA at the sequence GTTAAC. They cleave the cite…

Q: This is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction…

A: Restrictions endonucleases are enzymes that cut down the DNA into fragments near or at the site of…

Q: When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed…

A: It is related to molecular biology in which we use restriction enzymes an important tool for

Q: 5. You wish to map restriction sites in an unknown plasmid that has not been sequenced. You digest…

A: The process of fragmenting deoxyribonucleic acid strands with specific enzymes is restriction…

Q: A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is…

A: Let us consider the probability of finding the restriction sites in DNA at any position is '1 in x',…

Q: This enzyme will be added when the cells are lysed, detroying all RNA in the sample. Why will this…

A: INTRODUCTION Plasmid Plasmid are circular DNA and into which we can insert the DNA of our interest…

Q: If the size of the of a pDrive cloning vector is 3,850 bp and a mecA PCR product is inserted into…

A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…

Q: The partial sequence of one strand of a double-stranded DNA molecule is…

A: Restriction endonucleases  are the enzymes used in genetic engineering or DNA cloning in which…

Q: arac PKAN-R 5,512 bp PARA 4,872 bp BamH PBAD Bam 377 bp kank ampR PBAD-rfp 807 bp Hindill Hindli

A: Answer :  The ristricton enzmye used to make cut in the plasmid.  Both the plasmid should be cut…

Q: A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally,…

A: A map that shows the location of restriction sites within a sequence of DNA molecule is known as…

Q: Your cloning vector has restriction recognition sites for two restriction endonucleases, EcorI and…

A: Introduction Recombinant DNA technology enables us to construct DNA using the Recombination method.…

Q: 1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would…

A: As per our guidelines, we are supposed to answer only one question. Kindly repost the other question…

Q: Hindl EcoRI ECORV BamHI 373 Salt Pstl. tet amp Plasmid 1000 DBR322 4361 be ori Ndel you were going…

A: Restriction enzymes or restriction endonucleases/exonucleases are enzymes capable of recognizing a…

Q: You wish to perform an electrophoretic resolution of your restriction enzyme–digested DNA. The sizes…

A: Note: As per the guidelines we are answering the first question here. Please repost the other…

Q: Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR…

A: Polymerase chain reaction (PCR) is a method widely used to make many copies of a specific DNA…

Q: A eukaryotic gene is added to a mixture containing a restriction enzyme EcoRI and a bacterial…

A: Which media allow growth of bacteria that did not take up any plasmid?

Q: A newly discovered insect has a genomic DNA that does not contain any repetitive DNA or any intronic…

A:

Q: There are three classes of restriction enzymes; Class I, Class II and Class II. Nevertheless, Class…

A: Restriction endonuclease are the enzyme which make a cut in genetic material that is DNA somewhere…

Q: Many restriction endonuclease recognition sequences are palindromes. What are palindromes? Are the…

A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: plasmid has a total size of 2686 bp. There is an EcoRI recognition site at position 439, BamHI…

A: Plasmid  It is an extra chromosomal piece of DNA in the cell.

Q: The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA…

A: The following is the DNA information received by gel electrophoresis:   In lanes 1 and 2, each…

Q: Need help with question one

A: The plasmid is the extrachromosomal DNA present in the bacterial cell. These are the extra DNA other…

Q: 7. A 1000 bp EcoRI restriction fragment contains a gene you are interested in. The fragment was…

A: EcoRI is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction enzyme…

Q: DNA samples from four individuals were cleaved with the same MW restriction endonuclease. The DNA…

A: Any human biological specimen taken or preserved for the purpose of extracting and analysing DNA in…

Q: You want to clone the gene Dik1 into a plasmid that will be used to generate a transgenic mouse. The…

A:

Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical…

A: ANSWER;-  Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content =…

Q: An E. coli genomic DNA fragment is run out on a gel undigested (U), and then with two different…

A: Restriction enzymes are those enzyme which recognise a specific recognition site in DNA and cuts the…

Q: What is the dna strand sequence for phosphate sugar backbone?

A: Disclaimer: - According to Bartleby guidelines only the 1st question can be answered when multiple…

Q: A newly discovered insect has a genomic DNA that does not contain any repetitive DNA or any intronic…

A: Biotechnology is the use of our understanding of biological processes to develop useful applications…

Q: A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is…

A: The types of nucleotide bases of the genetic material are the same in all the species present on…

Q: A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid…

A: Plasmids are small, circular, double stranded, and extrachromosomal bacterial DNA. i.e. it is…

Q: U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…

A: A restriction endonuclease or restriction enzyme is a bacterial enzyme that cuts dsDNA into…

Q: Restriction endonuclease and ligase are two types of enzymes used in the process of genetic…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…

Q: For the following short sequence of double stranded DNA and the given primers, there will be one…

A: Polymerase chain reaction (PCR) is generally used to produce millions or even billions of copies in…

Q: Applications of PCR Consider this restriction enzyme (RE) named Hindlll 5...A AGCTT... 31 3...…

A: Hi ! Since you have posted multiple questions and haven't mentioned which to answer, we shall answer…

Q: A eukaryotic gene is added to a mixture containing a restriction enzyme EcoRI and a bacterial…

A: The EcoRI restriction site is present in tetracycline resistance gene. This meand that while…

Q: The following DNA fragment shows where a number of restriction endonucleases cut sites occur within…

A:

Q: A linear DNA fragment was produced by digestion with the restriction enzyme, Xba1. This fragment…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: 1. You have a circular plasmid (PUC57), which consists of 2710 bp. What would the number and length…

A: If we cut a circular plasmid at 2 sites then 2 fragments would be generated. Similarly, for 3 cut…

Q: 1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction sites. EcoRI…

A: Introduction By cleaving the internal covalent bonds between nucleotides, endonucleases breaks down…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.