Pls send solution fast within 10 minutes and i will give like for sure Solution must be in typed form Calcium ions bind to the SERCA Ca2+ -ATPase, which has two identical calcium sites, in two stages with apparent equilibrium constants K1=7×105M−1 and K2=2×106M−1 . a.) Calculate K. Note: K is not 0.1*1013 or 14*1011 or 1*1012. b.) Calculate τ.
Q: he human body requires various nutrients which are essential for health and can be obtained from a…
A: Proteins are comprised of amino acids polymer linked by peptide/amide bonds. Fats are insoluble…
Q: Why two strands of DNA are not identical but are complimentary to each other?
A: Introduction DNA acts as genetic material in our body. DNA consists of nitrogenous bases, pentose…
Q: 12. Which of the following ligands cannot act as an ambidentate ligand? o nitrite, NO₂ o…
A: Ligand is a molecule which bind reversibly to the protein. A ligand may be any kind of molecule, it…
Q: To completely reduce an oxidized cytochrome-c, how many electrons are required?
A: The electrons transport chain is a collection of four protein complexes: complex I, II, III and IV…
Q: argarines made from plants oils are healthier ,since they are hydrogenated. A) TRUE B)FALSE
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: 21. The structure of D-arabinose is shown below. How many stereoisomers are possible for this…
A: In carbohydrates, the carbon that is attached to four different groups is called a chiral centre.…
Q: Provide a simple sketch of the covalent intermediate likely to form between active site serine…
A: Serine, histidine, and aspartate all are amino acids. They all have different properties and…
Q: An aminoacyl-tRNA is initially bound to the ribosome in prokaryote at the A site on the 70S subunit…
A: A small RNA molecule known as transfer RNA (tRNA) is essential for the production of proteins.…
Q: What is the function of uncoupling proteins in hibernating mammals? ○ A) They allow protons…
A: Uncoupling protein 1 or UCP1 (thermogenin) and is important in helping animals keep warm during the…
Q: 1. What is Du? ESTIONS ON LABORATORY ASSAY NO.7 2. Why do we need test for Du when weak or no…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Which of the following does NOT correctly describe the fluid mosaic model of lipid bilayer? A.…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Q: In a case where the energy source to be used it 1 malate unit, exactly how many ATP can be yielded?…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP from oxidation of…
Q: Passage 1 (Questions 1-4) Human immunodeficiency virus 1 (HIV-1) protease inhibitors have been…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: DNA MELTING Two antiparallel single strands form a DNA duplex according to the following model: SA…
A: Gibbs's free energy, also known as free energy or G, is a thermodynamic quantity that represents the…
Q: From the following information determine the amino acid sequence of a peptide. N-terminal Edman…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Reabsorption of this substance involves carbonic anhydrase - inulin - bicarbonate - glucose -…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: Scope of Industrial biochemistry
A: Industrial biochemistry: The practice or application of set of chemical processes that occur within…
Q: Draw a schematic diagram illustrate the interactions made between the key components of total and…
A: Ligand and protein binding is vital phenomenon in our body for enzyme-substrates, enzyme-inhibitors,…
Q: Calculate hematocrit for Susie's whole blood sample, given the following information: RBC volume =…
A: Introduction Whole blood is composed of erythrocytes (RBC), platelets and leukocytes (WBC). The…
Q: In an enzyme-catalyzed reaction where enzyme concentration is held constant and substrate…
A: Enzymes are biological catalysts. They increase the rate of the reaction they catalyze. There are…
Q: Draw estimated macroscopic currants for Na and k by multiplying the single channel
A: The sodium-potassium pump is also known as the Na+/K+ ATPase pump. It is a type of active transport…
Q: Based on your knowledge of the natural amino acids, what would you expect pKa of the side chain of…
A: Succinic acid have 4 carbons, among which the two terminal carbons are carboxylic acid groups. The…
Q: 3. Prostaglandins (5) are derived from the 20-carbon fatty acid arachidonic acid in a reaction…
A: In order to solve this problem , we need to draw the Lineweaver Burk plot (LB plot). LB plot has…
Q: Figure 1 shows the structure of adenine and thymine. (i) (ii) NH H adenine -H =C thymine Figure 1…
A: These are cyclic compounds that contain nitrogen. They can be: Purines: a heterocyclic organic…
Q: 7. All amino acids have a chiral a-carbon EXCEPT A) Proline B) Alanine C) Glycine D) Tryptophan 8.…
A: Since you have posted multiple MCQ questions, we will provide the solution only to the first three…
Q: SEMINAR TOPIC Role of oxidative stress in the pathogenesis and complications of diabetes
A: Oxidative stress is caused by disparity between production and accumulation of oxygen reactive…
Q: ✓ Part B What further experiment should be carried out in order to determine the primary structure…
A: Introduction Protein is the most abundant macromolecule in our body. Amino acids are the building…
Q: Sulfur compounds give onions their unique flavor and properties. Compound 1 is the starting material…
A: Allinase is an enzyme which catalyzes a biochemical reaction in which S-alkyl-L-cysteine S-oxide…
Q: A ________ is a recognizable folding pattern involving at least 2 secondary structures and the…
A: Proteins are primarily synthesized as a linear chain of amino acids linked together via peptide…
Q: A 71-year-old man with enterococci infection is started treatment with 240 mg of intravenous…
A: A one-compartment drug kinetics assumes that the drug is readily absorbed, having a single entry and…
Q: 9. Briefly describe and draw the structure of the following disaccharides in their ring structure.…
A: A. Sucrose structure: O O| || || |O-C-O-C-H H-C-O-C-O| || || |H H B. Maltose structure: O O| || ||…
Q: . Although, the fuel sorce can be swapped into metabolism, you need specific enzymes and coenzymes…
A: Metabolism is consist of series of biochemical reactions in living organism for the sustenance of…
Q: Thiopurine S-methyltransferase (TPMT) is an enzyme that is responsible for the metabolism of the…
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: Subunit Composition of a Protein. A protein has a molecular mass of 400 kDa when measured by…
A: Size exclusion chromatography is a technique which separates molecules according to their size…
Q: In the liver, higher levels of NADH promote gluconeogenesis. I'm curious as to your thoughts on this…
A: Gluconeogenesis is defined as the de novo synthesis of glucose from a non-hexose or non-carbohydrate…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: What is the effect on the biosynthetic pathways if the oxidative branch of a person’s pentose…
A: The pentose phosphate pathway (PPP) is an alternate pathway to metabolize Glucose 6-phosphate…
Q: 1. Biochemical mechanisms of fatty acids and glycerol mobilization. 2. Metabolism of glycerol,…
A: Triglycerides are fatty acid esters of glycerol, where three fatty acid molecules are linked to one…
Q: Describe the role of sodium and phosphomolybdate reagent in Folin Wu method.
A: NOTE : Since you have posted multiple questions, we will provide the solution only to the first…
Q: How many total (NOT NET) molecules of ATP are synthesized from ADP via glycolysis of a single…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate. It…
Q: 3. Please draw the core structure of Lignan, and numbering the C-atoms.
A: In 1948, Haworth first introduced the term "Lignan", which are also subgroup of non-flavonoid…
Q: 8. The amino acid sequence for the beginning of the globular protein myoglobin is:…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: The AG of a reaction is positive. Which is TRUE? The cell cannot catalyze this reaction under any…
A: In a general reaction such as: A + B ⇌ C + D At equilibrium (steady state), the concentration of…
Q: O2 is a competitive inhibitor of the hydrogenase enzyme that catalyzes the conversion between…
A: A competitive inhibitor is a type of inhibition in which a inhibitor, binds to the active site of…
Q: 6. List four (4) organelle structures that are similar for both plant and animal cells. List the…
A: Cell organelles, or simply Organelles, are subunits present in a cell responsible for carrying out…
Q: Can you draw the table in paper instead?
A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as code…
Q: Question 13 1 The binding of seven molecules of ATP at the apical domain of the GroES causes the…
A: Since you have asked multiple questions, we will solve the first question (Question No. 13) for you.…
Q: 5. Ways of cholesterol biotransformation, their tissue localization: 5.1. extracellular (LCAT) and…
A: Sterols are lipids with the characteristic steroid nucleus. The steroid nucleus is four fused rings,…
Q: lon X has an equilibrium potential of Ex = -50 mV. At the resting membrane potential (-70mV), which…
A: Ions can move either way across a membrane but the direction of movement depends on membrane…
Q: The glycolytic enzyme aldolase catalyzes the following cleavage reaction: Fructose 1,6-bisphosphate…
A: Aldolase is an enzyme that catalyses one of the reaction of glycolytic pathway by performing a…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 2. The two diagrams to the right il- lustrate plots of steady-state ki- 5FA 0.8 netic studies to characterize the in- nH = 3.5 0.6- teraction of heart muscle phos- phofructokinase-1 with a non-phy- siological, synthetic substrate fruc- tose-6-sulfate. Because the kcat is 0.4- 0.2- smaller than that for the natural 10 μΜ 20 μΜ 48 μΜ substrate, higher enzyme concen- trations could be used. The results show the influence of increasing 0.2 0.4 concentrations of ATP on the initial -0.6- > velocity of the enzyme catalyzed reaction in the presence of no -0.8 4 12 20 28 36 44 52 60 68 76 84 92 1.2 2.0 2.4 AMP (•), 10 µM AMP (•), 20 µM AMP (-), and 48 µM AMP (). [ΑΤPΙ (μM) log[ATP] (µM) (а) how ATP interacts with the enzyme in the case of no AMP (•). Write the reaction in words catalyzed by the enzyme for the alternative substrate, describe (b) with respect to the binding of AMP and ATP to the allosteric effector sites on the enzyme. Explain the physical significance of the displacement of the…Below is an image of a calcium binding site on the calmodulin protein. What statement is correct regarding this Ca2+ binding? 140 ASN 136 GL IL 29 131 GL 132 133 Time left 1:1 O a. deprotonated acidic side chains are important for Ca2+ binding O b. Ca2+ binding usually does not result in conformational changes in a protein O c. deprotonated basic residues are important for Ca2+ binding O d. Ca2+ binding to proteins is usually done by coordination with one side chainin human 2. Human xanthine oxidase catalyzes the oxidation of hypoxanthine to xanthine and can further catalyze the oxidation of xanthine to uric acid. For the treatment of hyperuricemia and gout. several medications are used to inhibit the activity of xanthine oxidase and reduce the production of uric acid. You are a biochemist and just discovered a chemical that can inhibit the activity of the human xanthine oxidase. When analyzing its mode of inhibition, you found that the enzyme inhibitor complex requires 450 kJ.mol to dissociate and that it displays kinetics somehow similar to noncompetitive inhibition. You sent your inhibitor to the ministry of health for approval as a medication for gout. Based on the data provided, are they going to authorize it as a medication or not? Explain?
- 2. The two diagrams to the right il- lustrate plots of steady-state ki- netic studies to characterize the in- teraction of heart muscle phos- phofructokinase-1 with a non-phy- siological, synthetic substrate fruc- tose-6-sulfate. Because the kcat is smaller than that for the natural 5 0.8- NH = 3.5 0.6- 0.4- 0.2- 10 μΜ 20 μΜ 48 µM substrate, higher enzyme concen- trations could be used. The results show the influence of increasing 2 0.2- 0.4- concentrations of ATP on the initial -0.6- > velocity of the enzyme catalyzed reaction in the presence of no -0.8F 4 12 20 28 36 44 52 60 68 76 84 92 .2 2.0 2.4 ΑMP () , 10 μΜ AMP (+ ) 20 μΜ AMP (-), and 48 µM AMP (-). [AΤP] (μΜ) log[ATP] (µM) (a) . Write the reaction in words catalyzed by the enzyme for the alternative substrate, describe how ATP interacts with the enzyme in the case of no AMP (•). (b) ! with respect to the binding of AMP and ATP to the allosteric effector sites on the enzyme. Explain the physical significance of the displacement…1E In terms of binding adenylate kinase, the Kd for ATP is ~50 M and the KI for GMP-PCP is ~50 nM. Explain how this may be possible in terms of molecular interactions. Name 4 different types of molecular interactions that may contribute to the increased binding affinity exhibited by GMP-PCP. Please help me in details4. a. Calculate the KM (Michaelis constant) and the vmax (the maximum initial rate) for both substrates (sphingosine and ATP). Show your work, and be careful about units. b. threo-dihydrosphingosine, a stereoisomer of sphingosine, is an inhibitor of sphingosine kinase. What kind of inhibitor (competitive, uncompetitive, noncompetitive) is threo-dihydrosphingosine? Citing information from the Lineweaver-Burke plots, explain how you can tell.
- . Lysozyme is placed in a dialysis tube. The protein has a charge of +18 at pH 7.0. If the protein is dialyzed against 0.1L of 0.1M NaCl, predict the sign of the membrane potential using the Donnan Potential.ans fast I will upvote A sample of PbSO4 solid has reached equilibrium in a beaker of water. If the ionic strength of the solution is then increased by adding LINO3 salt what happens to the activity coefficients of the Pb+2 and what happens to the solubility of the PbSO4 choose the option and explain the activity coefficient will increase and the molar solubility will decrease Both activity coefficient the molar solubility will decrease the activity coefficient will decrease and the molar solubility will increase Both activity coefficient the molar solubility will increase. Studies on CAMP actions in cultured cells usually involve adding to the cell culture not CAMP, but dibutyryl CAMP (see structure). Why is this structural modification necessary? How could you test the premise that di-Bu-CAMP has the same biochemical effects as CAMP? N. N= Nat Dibutyryl CAMP O
- Which statements are true? Explain why or why not.1 The role of ATP hydrolysis in actin polymerizationis similar to the role of GTP hydrolysis in tubulin polym-erization: both serve to weaken the bonds in the polymerand thereby promote depolymerization.2 Motor neurons trigger action potentials in musclecell membranes that open voltage-sensitive Ca2+ channelsin T tubules, allowing extracellular Ca2+ to enter the cyto-sol, bind to troponin C, and initiate rapid muscle contrac-tion.3 In most animal cells, minus-end directed microtu-bule motors deliver their cargo to the periphery of the cell,whereas plus-end directed microtubule motors delivertheir cargo to the interior of the cell.2+ The activity of the Ca 2+ -ATPase is regulated reversibly under normal conditions to maintain homeostatic concentrations of Ca²- inside the sarcomere. However, in a rare genetic disorder, irreversible activation of the Ca 2+ -ATPase can occur. Assuming 37 °C, pH = 7.4, and the steadystate concentrations for ATP, ADP Pi, and Ca2+ (out) given in part (a), calculate the minimum [Ca2+] inside a sarcomere that has irreversibly activated Ca 2+ -ATPase (i.e., the Ca2+-ATPase activity is always “on”). Express your answer to two significant figures and include the appropriate units.Y ANTIBODIES DIETARY B12 PERNICIOUS ANAEMIA HYDROXYCOBALAMIN 5. Pernicious anemia is a disease in which the intestine is unable to absorb vitamin B12, frequently due to the loss of the generically named "intrinsic factor" produced by the parietal cells of the stomach lining. Intrinsic factor is a glycoprotein that binds to vitamin B₁2 and is required for its uptake in the ilium. Vitamin B12 is synthesized only by microbes, and we get it either from digesting animal protein or from our commensal microbiome. Vitamin B₁ is unique among metabolic cofactors in that it contains the trace element cobalt, coordinated in a corrin ring structure that is similar to the porphyrin ring system in heme. Loss of intrinsic factor, often through autoimmunity, results in the inability to absorb B12 and ultimately a loss of red blood cells that results in anemia and can be deadly ("pernicious"). ILEUM NUMBNESS (a) In pernicious anemia, N 5-methyltetrahydrofolate accumulates, and cells run out of…