Describe the role of sodium and phosphomolybdate reagent in Folin Wu method.
Q: Meselson-Stahl Experiment showed that DNA replication is semi-conservative. In the experiment, DNA…
A: DNA replication is the biological process by which two identical replicas of DNA from one original…
Q: Reabsorption of this substance involves carbonic anhydrase - inulin - bicarbonate - glucose -…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: In an enzyme-catalyzed reaction where enzyme concentration is held constant and substrate…
A: Enzymes are biological catalysts. They increase the rate of the reaction they catalyze. There are…
Q: .Here is an oligomeric protein, which has two binding sites: 1)Write the formulas of side chains of…
A: Oligomeric proteins are quaternary structure proteins which possess more than one subunit of…
Q: To completely reduce an oxidized cytochrome-c, how many electrons are required?
A: The electrons transport chain is a collection of four protein complexes: complex I, II, III and IV…
Q: Which of the following structures represent the same carbohydrate? CHO HO но- -Н EX Н -OH HOCH2 1…
A: Carbohydrates are polyhydroxy aldehydes or ketones. The general formula of carbohydrate is (CH2O)n.…
Q: Calculate length of tubes required for desired production rate
A: Proteins Proteins are the long chain of amino acids , they are essential for the structure,…
Q: Focusing on the mechanism linking complex I and ATP synthase depicted in figure 3 in the article,…
A: Peter Mitchell in t the chemiosmotic theory proposed that there exists a membrane localized,…
Q: Growth is an example of a ________ process. metabolic generative responsive control
A: Metabolism is the process of breakdown of complex biomolecules in food, in order to release energy.…
Q: Cholera is an acute, diarrheal disease caused by infection of the intestine with the gram-negative,…
A: Proteins are high molecular weight biomolecules made up of amino acid residues linked via peptide…
Q: Soy milk is rich in vegetable protein (about 4.5 grams of protein per 100 grams of soy milk) and…
A: INTRODUCTION : Proteins : Proteins are simple & complex biocompounds which are needed by the…
Q: The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn…
A: Proteins are polymers of amino acid residues linked via peptide bonds. Amino acids are biomolecules…
Q: The concentration of protein in a solution can be determined via UV spectroscopy and colorimetry*…
A: UV spectroscopy UV spectroscopy is a technique which uses the absorption of ultraviolet radiation by…
Q: Compared to an uncatalyzed reaction, an enzyme-catalyzed reaction ________. A) uses less substrate…
A: Enzyme kinetics is the study of the rates of chemical processes that are catalyzed by enzymes. The…
Q: Responses elicited by cAMP production EXCEPT glycogen breakdown increased secretion of…
A: G-protein is a GTP binding protein that is found closely associated with the receptor called…
Q: Briefly describe why mammals can not convert fatty acids to carbohydrates? Why plants can do so?…
A: Lifeforms are more or less a controlled and well regulated chemical lab in themselves. A whole lot…
Q: What is acrolein test? explain in 5 sentences essay
A: Triglycerides or triacylglycerides or simple fats are fatty acid esters of glycerols. In…
Q: iccharide. A チ OH CH₂OH 3 OH 3 с loftes to right alpha-glucosidic Bond. B 6 CH₂OH H OH 2 OH H CH₂OH…
A: Carbohydrates can be classified into monosaccharides ,oligosaccharides and polysaccharides.…
Q: Which of these is not a suitable test for assessing folate status? red cell folate plasma…
A: Folate formerly known as folacin is a water soluble vitamin B or B9 usually found in some foods…
Q: Although as a whole, metabolic pathways are thermodynamically favorable, there’s at least one…
A: The Delta G of a reaction can be calculated as follows. Delta G = Delta G0 + RTln(Q) Where R =…
Q: Answer (FMN, FAD), TPP, PLP, and Adenosylcobalamin and methylcobalamin.
A: Enzymes are biological catalysts that catalyse biochemical reactions. Most enzymes are made up of…
Q: 1. Which of the following statement is correct? a. Lipids can only participate in the TCA cycle. b.…
A: Metabolism of biomolecules is a interrelated process. The end product of one metabolic pathway can…
Q: What is the dissociation equilibrium constant of a protein if the concentration of free ligand is…
A: Consider the following reaction: P + L ⇌k2k1 PL where P is the protein, L is the ligand and k1 and…
Q: Which of the following is not a characteristic of DNA replication? O The synthesis of DNA is…
A: DNA carries all the genetic information needed to make an organism. DNA contains genes which are the…
Q: 1. 2. NaBr 3. H₂O₂ 4. Al₂(MoO4)3 5. AgNO3 Fe₂(SO4)3
A: In one molecule of a compound how many numbers of atoms of each element are present is…
Q: Which of the following is NOT a zymogen? A) Chymotrypsinogen. B) Proelastase. C) Enteropeptidase.…
A: Zymogens are inactive form of enzymes that upon successful cleavage and processing are converted to…
Q: *While acetyl-SCOA activates pyruvate carboxylase, it inhibits pyruvate kinase. Explain how this is…
A: Complementary control is a type of metabolic regulation by which 2 complementary pathways are…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: How many comparisons are needed to count the number of duplicates in a list? How many comparisons…
A: Codons are triplets of nucleotides (4 types of nucleotides, A, U, G, C) found on mRNA sequence which…
Q: Which is true about signaling receptors? They are transmembrane proteins that have binding…
A: Signalling receptors are the transmembrane proteins that span the plasma membrane of the cell. they…
Q: This assay is the most common method of detection in enzyme assays: A. рН B. spectrophotometric…
A: Enzymes are the biological catalysts that can convert substrate molecules to products. Enzyme assays…
Q: 1. Biochemical mechanisms of fatty acids and glycerol mobilization. 2. Metabolism of glycerol,…
A: Triglycerides are fatty acid esters of glycerol, where three fatty acid molecules are linked to one…
Q: Control of transcription in prokaryotes does not involve enhancers silencers Histone coding O…
A: Enhancers and silencers are DNA sequence acting as regulatory elements which acts as "turn on" or…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: All processes that would end up releasing energy will take place spontaneously. This energy released…
Q: I am confused what is HDI. pls define in easy words.
A: Lipoproteins are triacylglycerols, phospholipids, cholesterol, and cholesterol esters associated…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: Complex 2 oxidizes ___ and reduces __ a. FAD, COQ b. COQ , Cytochrome C C NADH, COQ d.…
A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in TCA cycle + 2…
Q: PLEASE HELP 1. How many chirality centers does ribose have? Identify them.
A: Chirality is a property that is exhibited by molecules that cannot be superimposed on their mirror…
Q: rue or false 1. Cytochrome p450 is considered to be the “universal oxygenase” 2. In alzheimer’s and…
A: Oxygenases are enzymes that oxidise substrates with molecular oxygen. PD and AD are neurological…
Q: By the reaction catalyzed by the pyruvate dehydrogenase complex: a) NAD+ is oxidized to become NADH…
A: The glycolytic process results in pyruvate, which is a substantial source of acetyl-CoA for the TCA…
Q: Review what is enzymes/catalysts? How do you increase/ decrease the reaction? What happens to the…
A: Introduction: Enzymes are proteins in nature and their action is specific. It functions…
Q: For Gal(Beta 1 - 4)Glc, Explain in detail the glycoside bond: What carbon involved in glycoside…
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: The ultimate acceptor of electrons in the nadh electron transport chain is a. H+ b. ATP c. O2…
A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in TCA cycle + 2…
Q: 1 Draw the following polypeptide: Met- Tyr-Val-Ser-Asn 2A Draw the hydrolysis of a dipeptide…
A: A peptide is a chain of amino acids, in which the amino acids are joined together through peptide…
Q: Which of the following mutations is most likely to cause a loss of protein function? O a. Silent…
A: As per the central dogma of biology, the genetic information stored in the DNA is copied onto an…
Q: how ecstacy affects the brain?
A: 3,4-methylenedioxy-methamphetamine which is commonly known as MDMA or Ecstasy is a syntheic drug. It…
Q: Close circuit of tubes through which blood flows
A: The function of blood flow is to deliver oxygen to the different tissues and organs. Blood flow also…
Q: Clinical Chemistry The concentration of Nations in red blood cells (11 mM) and in the surrounding…
A: The unequal separation of ions across a membrane will lead to the generation of a potential…
Q: The citric acid cycle enzyme at which FADH2 is generated is: OA) isocitrate dehydrogenase. OB) B)…
A: Citric acid cyclei s the main source of adequate energy for cells and a significant part of aerobic…
Q: Given the Lewis structure below: HO H H C C C C CIH There are sigma bonds and pi bonds.
A: Sigma and pi bonds are types of covalent bonds that differ in the overlapping of atomic…
1. Describe the role of sodium and phosphomolybdate reagent in Folin Wu method.
2. Describe the accuracy and specificity of Nelson-Somogyi method
3. Do you think PFF should be part of enzymatic method of glucose determination? Explain your answer.
Step by step
Solved in 2 steps
- 1. Describe the accuracy and specificity of Nelson-Somogyi method 2. Do you think PFF should be part of enzymatic method of glucose determination? Explain your answer.1. If you are a medical technologist, which of the four methods of glucose determination would you employ? why? 2. Do you think PFF should be part of enzymatic method of glucose determination? Explain your answer. 3.Describe the accuracy and specificity of Nelson-Somogyi method.1. Give the importance of carbohydrate fermentation test in biochemical testing and enumerate the enzymes that are involved. 2. What are the substances added in the culture media utilized by the organism producing hydrogen sulfide? Give 2 other media used for the production of hydrogen sulfide. 3. Explain the mechanism taking place in the hydrolysis of urea which leads to the formation of bluish red color. 4. Discuss why human blood plasma will not always yield reliable results.
- Q. You have now carried out the Somogyi Nelson determination of reducing sugars and measured the absorption spectra of Tube 9. What is the optimum wavelength you should use to monitor the Somogyi Nelson Assay why? Table 1._SOMOGYI-NELSON DTERMENATION OF REDUCING SUGARS Tube 1 2 3 4 5 6 7 8 9 10 D-Glucose (160 µg/mL), mL 0 0 0.125 0.125 0.25 0.25 0.375 0.375 0.5 0.5 H2O, mL 0.5 0.5 0.375 0.375 0.25 0.25 0.125 0.125 0 0 D-Galactose (160 µg/mL), mL - - - - - - - - - - D-Arabinose (160 µg/mL), mL - - - - - - - - - - Glucose-Galactose Mixture, mL - - - - - - - - - - Absorbance (710 nm) 0.049 0.051 0.138 0.151 0.271 0.26 0.382 0.395 0.454 0.444 Absorbance - blank 0 0 0.088 0.101 0.221 0.21 0.332 0.345 0.404 0.394 Final [Reducing sugar]…Match the chemical reaction to the visual effect of the product/biochemical test description 1. This assay's color change relies on an initial reduction reaction resulting in a black precipitate if the organisms is "positive" 2. The visual production of gas from this reaction indicates this organism can break down toxic byproducts of aerobic respiration. 3. This assay relies on a pH indicator (phenol red) for a color change. An organism that was "positive" for the certain enzyme in this assay, would result in a pink color change. 4. If an organism was incubated in simple broth containing a phenol red pH indicator and a sugar source, and the broth turned yellow following bacterial growth, that would be evidence of this reaction occurring. 5. The reaction representing this assay, works by producing a red colored product upon addition of a reagent, which tells us the organism possesses the enzyme required to break down a particular amino acid.1. Give the importance of carbohydrate fermentation test in biochemical testing and enumerate the enzymes that are involved. (5 points) 2. What are the substances added in the culture media utilized by the organism producing hydrogen sulfide? Give 2 other media used for the production of hydrogen sulfide. (5 points) 3. Explain the mechanism taking place in the hydrolysis of urea which leads to the formation of bluish red color. ( 5 points) 4. Discuss why human blood plasma will not always yield reliable results. (5 points)
- 1. Give the results and interpretation from the biochemical tests of Escherichia coli in Triple Iron SugarUrine samples for each patient were tested for ketone bodies, and a Benedict's reagent and glucose oxidase reaction was also completed. The results are given in the table below, with indicating a negative result and +, ++ and +++ indicating a positive result of different intensity. Patient A Patient B Patient C Patient D Patient E Ketone Bodies - +++ Benedict's Reagent +++ +++ +++ Glucose Oxidase +++ +++ + 4. For each individual patient A-E, using the WHO guidelines for the diagnosis of diabetes, write a short paragraph to explain: (b) whether this deduction is confirmed by the detection of ketone bodies and sugar in the urine samples from that patient ||answer the following questions 1.What is the wavelength used for the spectrophotometer? What is the principle of the spectrophotometer? 2.What is the reagent used to detect glucose in the oh and temperature experiments? What is its principle?3.What is the optimum temperature for invertase reactions?4.What is the optimum ph for the invertase reactions?
- Can you classify the following biochemical tests based on the following criteria and explain why you did so? Test based on the presence of extracellular enzymes Test based on the presence of intracellular enzymes Test ased on carbohydrate fermentation Test based on protein catabolism 1. Catalase Test 2. Oxidase test 3. MacConkey agar (MAC) Medium Test 4. Mannitol Salt Agar (MSA) Medium Test 5. Gelatin Hydrolysis 6. Indole Production 7. Motility-Indole-Ornithine Decarboxylation Test 8. Methyl Red / Voges-Proskauer (MR/VP) Test 9. Nitrate Reduction Test 10. Simmon’s Citrate Agar Slant 11. Triple Iron Sugar Test 12. Urease Test1. Comparative characteristics of bioenergetics of aerobic and anaerobic glucose oxidation, Pasteur effect. 2. The role of Ca2+ in muscle contraction. 3. The patient blood test after a course of atherosclerosis treatment showed an increasing a level of antiatherogenic fraction of lipoproteins. The increase of what lipoprotein may confirm the effectiveness of treatmentThe plate below is a test of 7 different antibiotics against Enterobacter aerogenes. The center disc is Ciprofloxacin 15 micrograms) and the 24 hour extent of the Zone of Inhibition is the farther diameter. The one below it and slightly to the right is Chloramphenicol (30 micrograms) [see red arrow}. Give me the extent of the Zone of Inhibition in mm (yes, use a ruler and measure it at the size it comes up on your computer screen), then use the Standard Table and determine R, I, S for each. Antibiotic Zone of Inhibition (mm) R, I or S Drug target Ciprofloxacin Chloramphenicol Which of the 2 drugs is more selective and why?