IX. Draw the structure of the polynucleotide below which corresponds to a codon in the mRNA that codes for the amino acid proline. (Only a drawing of the structure following the polynucleotide model is requested)
Q: Consider the role of Histidine in the Serine protease mechanism and sketch a plot showing he…
A: Enzymes are biological catalysts that increase rate of biochemical reactions.Serine proteases are…
Q: Metabolizing a fatty acid via the B-oxidation pathway will generate acetyl CoA, NADH and FADH2.…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbons to 36 carbons.…
Q: The carbohydrates (CHOs), with a general formula of (CH₂O)n, are rich in hydroxyl groups. This…
A: Carbohydrates are the most abundant of all biomolecules present on the earth. Likewise, they play a…
Q: Calculate AG for the reaction G + H I + J when [G] = 0.0132 mM, [H] = 35.1 uM, [1] = 55.6 uM, [J]…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: 11.71 Provide the three-letter amino acid sequence expected from each of the following mRNA…
A: mRNA:Messenger ribonucleic acid (mRNA) is a single stranded RNA molecule that is read by a ribosome…
Q: Catalase Yeast Test
A: Catalase:It is an enzyme which catalyzes the decomposition of H2O2 into H2O and O2 .This enzyme is…
Q: B. Carbohydrate Reaction D-Talose is a C2 epimer of D-galactose. Using the Fischer projection…
A: Kinases are enzymes that transfer a phosphate group from ATP to its substrate. A C3 kinase…
Q: Glucose 1-phosphate formed by glycogen degradation is converted to glucose 6-phosphate by…
A: Glycogen is a stored form of glucose and is reserve food material in animals. Glycogenolysis is a…
Q: A graph of 1/vo vs 1/[S] is shown below. The y intercept is 6.6 and the slope is 133.3. Determine…
A: We know that LB plot is a doublerms reciprocal plot which is made by plotting inverse of substrate…
Q: Which statement best describes the principle behind the succinate dehydrogenase (SDH) assay used in…
A: The question is asking for the best description of the principle behind the succinate dehydrogenase…
Q: Please answer the following answer: Ethanol metabolism has been part of the human diet for…
A: The question is asking about the effects of high concentration of NADH, a product of ethanol…
Q: 3. Answer the following problem and explain your answer for better understanding Which of the…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbons to 36 carbons.…
Q: Proflavine was used to treat wounded soldiers in the Far East during the second world war. Which of…
A: A derivative of acriflavine, proflavine is bacteriostatic and disinfecting against a wide variety of…
Q: (a) The mean residence time of any single component i is given by (1-8)(1+K₁) "₁ UE where u is fluid…
A: (a) Mean Residence Time :The mean residence time is the average time a solute molecule spends in…
Q: HENRY is a peptide sequence. 1) Draw the structure of the HENRY peptide as it exists at pH 7. Be…
A: Peptides are composed of amino acids joined to each other via peptide bonds. Peptides can have one…
Q: Cofactors and coenzymes act to View Available Hint(s) O inhibit the binding of the substrate Oblock…
A: Coenzyme: The organic non-protein compound that loosely binds with an enzyme to catalyze the…
Q: Firefly luciferase is the enzyme that allows fireflies to illuminate their abdomens. Because this…
A: Consider the two reactions given below.Reaction 1 : Reaction 2 : If these two reactions are coupled…
Q: CH3CO3H
A: The given reaction is a reaction of ketone and per acid. The product of this reaction is an ester.…
Q: enzyme catalysts
A: Enzymes, the intricate conductors within organisms, stand as elaborate proteins crafted for…
Q: Draw three repeating segments of the polymer of cotton, and beta cellulose
A: CottonCotton is made up of organic molecules with composition of hydrogen, carbon and oxygen forming…
Q: In a Lineweaver-Burk graph, the lines representing the uninhibited and inhibited enzyme catalyzed…
A: Amino acid residues are linked together to form long chains called polypeptides. A polypeptide folds…
Q: The tyrosine absorption spectrum shows two peaks, one at 225 nm and one at 272 nm. What is the…
A:
Q: The initial rate for an enzyme-catalyzed reaction has been determined at a number of substrate…
A: MM plot is Michaelis Menten plot which is constructed by taking Substrate concentration on X axis…
Q: Carbohydrates differ in solubility based on the size of the molecule. Which of the following…
A: Carbohydrates are the biomolecules which are classified into monosacharides, oligosaccharides and…
Q: This is a picture of the catalysis of alcohol by ADH with an inhibitor binding as an aldehyde…
A: Classification of the enzymeAlcohol dehydrogenase (ADH) is an oxidoreductase.. Oxidoreductases are…
Q: What if the phosphate group for the glycolysis reaction with enzyme glyceraldehyde 3-phosphate…
A: During the process of glycolysis, glyceraldehyde 3-phosphate dehydrogenase catalyzes the…
Q: What does an enzyme change relative to an uncatalyzed reaction? a) The rate of the reaction. b) The…
A: Enzymes are biological catalysts. All enzymes are proteins except some RNA molecules that also show…
Q: pyruvate dehydrogenase complex a-ketoglutarate dehydrogenase Pyruvate + succinate dehydrogenase…
A: Respiration is an essential process that occurs in all living beings in which oxygen is utilised and…
Q: Consider this simplified diagram of the catabolism of proteins. protein hydrolysis amino acid B…
A: Proteins are macro molecules which are made up of amino acids bonded through a peptide bond.…
Q: On the paper provided, draw the chemical structure of a peptide with a sequence LEMD at pH 7. The…
A: Here, we are given the peptide LEMD. There are 4 ionizable groups in the peptide. They…
Q: [AktivGrid] Draw the ketone body formed in ketogenesis from the condensation of two acetyl CoA…
A: Acetyl-CoA is a molecule that plays an important role in many biochemical reactions in protein,…
Q: 3. Read the article "An update of the chemiosmotic theory as suggested by possible proton currents…
A: The chemiosmotic theory (some would argue that it is still a hypothesis and not a theory) has been…
Q: Which analogue involves a retroinverso peptide isostere? CH₂ A с CH3 Ö G O NH FX NH S OH OH S B D S…
A: Retro-inverse peptide:1. The sequence of parent chain is reversed such that the N side to C side…
Q: 5. Please draw typical curves of the relationship between enzyme catalytic rate(v)and substrate…
A: Enzymes are proteins that catalyze biochemical reactions. Catalytic activity refers to the rate at…
Q: The first recombinant human growth hormone (available in 1985) had an extra amino acid (relative to…
A: Human growth hormone (hGH or HGH), commonly referred to as somatotropin or growth hormone (GH), is a…
Q: The phosphoinositide (IP3) receptor is of which type? A) 7-TM b) binds tyrosine kinase c) has…
A: Note: Since you have posted multiple questions with multiple sub parts, we will provide the solution…
Q: odd-chain fatty acids are metabolized down to propionyl-CoA (a 3 Carbon unit). This is converted in…
A: The fatty acids are the building blocks of the fat in our bodies and in the food we eat.During…
Q: The characterization of an enzyme usually includes the determination of key kinetic parameters.…
A: vo: initial rate of reaction or rate of reaction when all the enzyme is yet to be saturated with…
Q: In the following reaction, a molecule of ATP bound to the enzyme transfer a phosphate to fructose…
A: Correct Option: b. The change in the activation energy barrier is greater than 27.6…
Q: The reaction in gluconeogenesis catalyzed by Glyceraldehyde-3-phosphate dehydrogenase (GADPH)…
A: Gluconeogenesis is the anabolic pathway that generates glucose from non-carbohydrate precursors like…
Q: Part C Elastase is closely related to chymotrypsin. Suggest two kinds of amino acid residues you…
A: there are four classes of biological macromolecules: nucleic acids, proteins, lipids and…
Q: Which of the following regarding DNA replication is FALSE. Replication of DNA is highly regulated.…
A: There are four classes of biological macromolecules: Nucleic acids, proteins, lipids and…
Q: Part A Are mannose and galactose, allose and altrose, gulose and talose, and ribose and arabinose…
A: Enantiomers are the pair of molecules that are non superimposable mirror images to each other. They…
Q: One of the reasons for oxidizing the disulfide bonds in RNase A before removing the urea in the…
A: In the Anfinsen experiment, Christian Anfinsen aimed to investigate the relationship between the…
Q: 1. Hen Egg Lysozyme (HEL) is a commonly studied protein. One study reported that HEL unfolded at a…
A: The free energy changes in chemical reactions are denoted by ΔG.∆G = ∆H − T∆Swhere ∆H is the…
Q: 1/1* Consider the structure below. Which of the following structures are not expected to be found in…
A: The structure given in the question is an anti-bacterial drug named Prontosil. It undergoes…
Q: ?What is the unique feature of the collagen helix compared to the a helix Hydrophobic interactions a…
A: There are four classes of biological macromolecules: proteins, nucleic acids, lipids,…
Q: 16. Please name the Glycosidic bond of the following disaccharides
A: A glycosidic bond is a covalent bond that links a carbohydrate molecule to another group, which may…
Q: Enalaprilat is a competitive inhibitor of the angiotensin-converting enzyme (ACE), which cleaves the…
A: Here, ACE is the enzyme, angiotensin I is the substrate and enalaprilat is the inhibitor.Given…
Q: Draw the product of the reaction of acetyl CoA with ACP-SH catalyzed by malonyl-CoA-acetyl-CoA-ACP…
A: ACP-SH is known as acyl-carrier protein (ACP–SH).This protein is part of a multienzyme complex…
Step by step
Solved in 3 steps with 1 images
- 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this geneThe mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the MRNA derived from this fragment? (b) Find the initiation and stop codons in this MRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect?
- Given this mRNA strand: 3’ - AUGAGGAAGGUA - 5’; what are the components of the polypeptide?Provide the abbreviation for the amino acid sequence expected from the following mRNA segment using the three-letter amino acid codes: 5' UUUICCCIAAUIAUUIACG 3'Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
- Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.
- 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAGA segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)