Q: Demonstrate the consequence on following translation of the insertion of an adenine base to the…
A:
Q: peptide bond formation is catalizyed at the larger ribosomal subunit. does this happend in…
A: Translation includes three phases: initiation, elongation, and termination. Initiation is a phase in…
Q: When an intron is undergoing the first step in splicing, where is the first breakage of the…
A: Gene splicing is a post translational process, which is a characteristic of eukaryotes and it…
Q: Describe the sequence in bacterial mRNA that promotes recognition by the 30S subunit.
A: RNA or ribonucleic acid is a polymer of ribonucleotides connected together via a phosphodiester…
Q: Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will…
A:
Q: In the splicing of group I introns shown, does the 5′ end of the intron have a phosphate group?…
A: Introns are the inert elements in the DNA. They are otherwise said to be non coding regions of DNA…
Q: Name four major classes of DNA-binding proteins that are responsible for controlling transcription,…
A: Replication protein A Transcription factor TAL effectors Zinc finger
Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5
A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…
Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?
A: Introduction :- In molecular biology , different processes of gene expression is studied , these…
Q: What is the molecular weight of an mRNA that codes for the protein of molecular weight 75000KD?…
A: The translation is a process in which protein gets synthesized from mRNA template. It occurs in 3…
Q: Given this MRNA strand: 3 - AUGAGGAAGGUA - 5"; what are the components of the polypeptide?
A: The polypeptide is formed by decoding the triplet codons using the codon table given. The mRNA…
Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…
A:
Q: What would be the likely effect of a mutation that prevents s from dissociating from the RNA…
A: RNA polymerase or DNA dependent RNA polymerase is an enzyme that synthesizes RNA from the template…
Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…
A: The synthesis of m RNA from DNA is called transcription.
Q: The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb.…
A: Because the gene contains introns (non-coding regions within the gene) that are removed during the…
Q: A protein domain that recognizes 5-methylcytosine in the context of double-stranded DNA has been…
A: SET and RING-finger-associated (SRA) domain is involved in establishment and maintenance of DNA…
Q: The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified…
A: The pairing of tRNA anticodon with mRNA codon lead from the 5’ end of codon. The first 2 position…
Q: During periods of starvation, translation of only vital mRNAs must occur inside a cell. Explain how…
A: The pre-mRNA is composed of two regions, one is the intron, and the other is the exon. The…
Q: Transcription occurs at a rate of about 30 nucleotides per second. is it possible to calculate the…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this…
A: In the normal hemoglobin molecule protein, has a glutamic acid (an amino acid) at the sixth position…
Q: From this overall anticodon sequence in tRNA,…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Although Ribosome binding site sequence vary considerably in different genes, they include examples…
A: Ribosome binding site (RBS) includes a sequence of nucleotide, which are present upstream the…
Q: N' C' = Polypeptide X d a b = SRP 5'- = translocator e Which region(s) of polypeptide X would bind…
A: Ribosomes refer to the site where the protein synthesis takes place. It comprises rRNA and protein.…
Q: List and briefly explain. C-terminal domain of RNA polymerase II function to ensure that the varoius…
A: RNA polymerase II is a multuprotein complex that transcribes DNA into precursors of messenger RNA…
Q: The free energy of binding of codon on mRNA and anticodon on tRNA is -9 kT. What is the probability…
A: In thermodynamics, free energy is the function of internal energy, entropy, and enthalpy. The…
Q: Suppose the following peptide chain was attached to a gly -tRNA during translation : met -leu-asp…
A: Serine will be added next to glycine in the growing peptide chain through formation of a peptide…
Q: True or false: A fully assembled 70S ribosome is recruited to the mRNA just 5 ́ of the translation…
A: The translation begins with the attachment of messenger ribonucleic acid (mRNA) with the ribosome.…
Q: List all possible codons present in a ribonucleotide polymer containing U and G in random sequence.…
A: Molecular biology is the study of biology at a molecular level. It studies the composition,…
Q: Define the pre-mRNA & mRNA spliceforms of Mutuallyexclusive exons ?
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: Consider à ollowing sequence: His-Cys-Leu-lle-Met where Met is at the C-terminus end. Based on the…
A: Amino Acids are are structures linked by Peptide Bonds to Form Polypeptide Chains. Proteins are…
Q: Assuming that each nucleotide is 0.34 nm long in mRNA, howmany triplet codes can simultaneously…
A: Nucleotide : It is an organic molecule that is the building block of DNA and RNA. They also have…
Q: Which of the following are elongation factors involved in the attachment of new aminoacyl-tRNAs?…
A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as code…
Q: Describe the effects of intron phase on alternative splicing with diagram
A: Alternative splicing involves the removal of introns from the mRNA transcript as introns are the…
Q: How many amino acids are coded for by the following mRNA: 5…
A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…
Q: what is the difference between leader mRNA and attenuator sequence? Please explain the function of…
A: Operon is a genetic regulatory system found in bacteria and their viruses in which genes coding for…
Q: What polypeptide product would you expect from apoly-G mRNA that is 30 nucleotides long?
A: Introduction:- The mRNA is composed of nucleotides .A series of 3 bases is a codon.Each codon codes…
Q: Mhich of the following polypeptides is coded for my the MRNA sequence 5' AUGGUUAAACGACAAUCC 3 ?
A: The amino acids are selected and wrote in the sequence as first, second and third base. The process…
Q: UGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the name of the sixth amino acid in the protein formed from…
A:
Q: Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G…
A: The above mentioned elongation factors are involved in the process of translation in prokaryotes.…
Q: What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300…
A: To determine: To determine the required minimum length of an mRNA that is coded for a protein of 300…
Q: The a chain of eukaryotic hemoglobin is composed of 141 amino acids. What is the minimum number of…
A: There is an intimate connection between genes and synthesis of polypeptides or enzymes. Genes are…
Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…
A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…
Q: List three factors that do not foster a-helix formation.
A: Proteins are one of the major macromolecules that contain long chains of amino acids. The structure…
Q: 1d) What amino acid would a tRNA with the anticodon 5'AGG³' carry?
A: The amino acids are the fundamental structural unit of proteins. There are 20 amino acids that code…
Q: Using the genetic code table, find the sequence of amino acids coded by the 2 DNA sequences (documi…
A: Transcription is the process by which the genetic information in the DNA segment is copied into an…
Q: The unfinished peptide fMet-Arg-Ser-Tyr-Gln-Cys-Pro is held in the P-site of the 70S ribosomal…
A: As each consecutive complex of amino acid-tRNA attaches to the ribosome's A site, one GTP is…
Given this mRNA strand: 3’ - AUGAGGAAGGUA - 5’; what are the components of the polypeptide?
Step by step
Solved in 2 steps with 1 images
- Second letter UGU UGCCYS UCU UAU UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp UUU Phe UUC. UCC Ser UCA UUA Leu UUG S UCG CAU CUU CUC Leu CỦA CGU CCU CC ССА CCG His CAC CGC Pro Arg CAA CGA Gln CUG CAG CGG AGU AGC AGA AAU ACU ACC ACA AUU Ser AUC File A AUA Asn AAC. AAA AAG Thr Lys AUG Met ACG AGG Arg GCU GCC GCA GCG GGU) GGC Gly GUU GUC Val G GUA GAU) Asp GAC Ala GAA Glu GAGJ GGA GUG GGG A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5'. What is the codon on an RNA strand transcribed from this series of nucleotides? Which amino acid results from this codon? Use the genetic code to answer this question. Edit View Insert Format Tools Table 12pt Paragraph Av ev T? MacBook Pro 20 00 000 23 $ % & 7 First letter Third letter * OC 全First Second Third position (5'end) position (3' end) position U A G UAU TyrY UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UCU Ser UCC Ser UCA Ser UCG Ser UGU Cys C UGC Cys UUA Leu UUG Leu UGA Stop UGG Trp W CAU His L CÁC His CGU Arg CGC Arg CUU Leu CCU Pro CỤC Leu FL CUA Leu ССС Pro - P CCA Pro CAA GIn Q CAG Gln R CGA Arg CGG Arg_ CUG Leu CCG Pro AUU lle ACU Thr AAU Asn AGU Ser ACC Thr -T ACA Thr AUC le AAC Asn. AGC Ser AAA Lys K AAG Lys AGA Arg -R AGG Arg AUA Ile AUG Met M ACG Thr GAU Asp -D GAC Asp_ GGU Gly GGC Gly GUU Val GCU Ala U GCC Ala - A GCA Ala GUC Val G GGA Gly GGG Gly - V GAA Glu -E GAG Glu GUA Val A GUG Val GCG Ala G Nonpolar Polar Basic Acidic Stop codon Table 4.1 Biology: How Life Works, Third Edition © 2019 W. H. Freeman and Company Consider this messenger RNA sequence: 5'-AUG UCG UAC ACU GCG --3' • Make a change in this sequence. Write a different version of this sequence that has nonsynonymous (missense) mutation. • Make a change in this sequence. Write a different…C A UUU U UUC Phe UCU UCC UCA UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop Stop UGG Trp G Tyr Ser UUA UUG Leu UCG CUU C CUC CUA CCU Leu ccc CCA CCG CAU CAC CAA His CGU CGC CGA CGG Pro Arg 1st Gin CUG CAG 3rd letter AUU A AUC AUA AUG ACU AAU AAC Ser u letter C Asn AGU AGC AGA AGG lle ACC Thr ACA AAA AAG Lys Arg Met ACG GUU G GUC GUA GUG GCU GCC GCA GCG GAU GAC GAA GAG Asp GGU GGC GGA GGG Val Ala Gly Glu Not all of the following ingredients are necessary for an in vitro translation reaction. Which one would you leave out? A ssDNA template O Cell sap containing ribosomes poly(U) O 14C-Phe
- Second letter UUU UUC UUA UUG. UCU UCC UCA UCG UAU Tyr UAC. Ser UAA Skp UGIA Stop UGU UGC. Phe Cys Leu UAG Sop UGG Trp CGU CGC Arg CGA CCU CAU CUU CUC CUA CUG His CAC CAA CAG Gin CCC Pro CCA Leu CCG CGG ACU AAUA AGU ]Ser AUU Asn AAC AGC AGA LArg AGG. AUC Be ACC ACA Thr AAA AUA AUG Met ACG MGys GUU GUC Val GUA GCU GCC GCA GCG Ala GAA Glu GAG GAU GAC Asp GGU GGC Gly GGA GGG GUG You come across four polynucleotide strands. The first is an original RNA strand that codes for a protein; the others are similar to the original RNA strand, except that each displays a point mutation. The point mutations are shown in red. 5' - AUG-UGC-AUU-CCU-GCA-UAA - 3' 5' - AUG-UGA-AUU-CCU-GCA-UAA - 3' 5' - AUG-UGC-AUU-CCC-GCA-UAA - 3' 5' - AUG-UGC-GUU-CCU-GCA-UAA - 3' Original RNA: Mutant RNA 1: Mutant RNA 2: Mutant RNA 3: 1. Based on how they will affect the protein product, identify the type of point mutation (missense, nonsense, silent, or frameshift) present in the Mutants 1, 2, and 3. 2. State which of…C UUU UUC Phe UUA UCU) UCC UCA UAU UAC Tyr UGU UGC Cys Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG FLeu UCG CUU CUC CCU] СС CAU1 CAC САC His САА Gln CGU CGC Arg Leu Pro CUA CUG ССА CGA CUG J CCGJ Which of the following tRNA anticodons could theoretically base pair effectively with the codons 5'-AAU-3' and 5'-AAC-3' through third-base CAG, CGG AGU AAUASN AGC AUU AUC File A AUA ACU АСС АСА AAC FAsn AAA Ser C Thr AGA Arg A AUG Met ACG AAG Lys AGG GCU] GCC GCA GCG GGU GGC Gly GGA GAU1 GUU GUC GUA GUG Asp GACJ GAA C Val Ala A GAG Glu GGG wobble? 5'-GGG-3' OI. 5'-AUG-3' II. 5'-GUU-3' I. 5'-CAT-3' IV. 5'-AAA-3 V. Third letter UCAG UUAG A, First letterConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-UACCGAAUGUCU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs by substitution of the 12th nucleotide with cytidine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.
- First base U A G U UUU UUC UUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or start Val Second base C A UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UGU Tyr Cys UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg Gly UCAG UCAG ט כ с AG А U ט כ C G Third base A mutation in the DNA that codes for hemoglobin changes the sequence CTC to CAC. This will cause a change in the mRNA from (original) ? to (mutated) __?____, resulting in the addition of the amino acid, (mutated) ____?___, instead of (original) ____?_Page 1: Second Letter C 1 2 UUU U UUC UUA Phe UCU UCC UCA UCG UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop UGG Tyr -- Ser Leu Stop A Trp G UUG CUU C CUC CCU Leu cc CAU His CGU Pro CAC CGC Arg CUA CUG CCA CCG 1st СА Gln CGA CAG CG 3rd letter AUU A AUC AUA AUG ACU ACC ACA AGU Ser AGC u letter AAU AAC AAA AAG Asn He Thr AGA AGG A Arg G Lys Met ACG GUU G GUC GUA GUG GCU GCC GAU Asp GGU GGC U Val GAC GAA GAG Ala Gly GCA GGA GGG Glu GCG 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5' a. direct transcript? b. transcript for translation? c. direction of a? (3' to 5' or 5' to 3') d. direction of a (3' to 5' or 5' to 3') e. translated peptides?3 attempts left Check my work Be sure to answer all parts. Re Consider the following sequence of DNA: 3'-AGA CCC-5'. a. What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CCC to CCA in DNA, what dipeptide is formed? Gu c. If a mutation converts CCC to CGC in DNA, what dipeptide is formed? d. If a mutation converts CCC to GCC in DNA, what dipeptide is formed? a. b. c. d.
- please dont copy ur answer from chegg since the answers there on this quiestion are not correct/reliablePAYS- DASO บบบ 1 UUC UUA UUG CUU CUC CUA CUG U '} GUU GUC GUA GUG PHE LEU AUU AUC AUA AUG MET or START LEU ILE VAL UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second base SER PRO THR ALA UAC} TYR UAA UAG } STOP CAU CAC CAA CAG} AAU AAC AAA AAG J HIS GLN ASN LYS GAU ASP GAC GAG GLU UGU CYS UGC UGA} STOP UGG TRP CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG ARG SER ARG GLY SCAR SCAG Аg each label into the appropriate position QRS complex Alpha wave P wave ST segment Twave Copyright McGraw-Hill Education. Permission required for reproduction or display 5 of 20 Next > S.