DNA replicates, how is it able to “unwind” its double helix
Q: 1. If a DNA molecule contains 11% G, what % A does it contain? 2. The human genome contains 3…
A: 1. If a DNA molecule contains 11% G, what % A does it contain? G = 1 1 % ( Given )A =?According to…
Q: DNA exists in cells as a double-stranded duplex molecule, whereas RNA, which is composed of very…
A: DNA and RNA are found in diverse forms and structures to facilitate particular functions. These…
Q: 1. Describe what you saw on the boundary between the fruit mixture and the alcohol. 2. Based from…
A: During cell division, deoxyribonucleic acid (DNA) is an inherited molecule that passes genetic…
Q: 3) Where is Deoxyribose sugar found? Where is Ribose sugar found? 4) What are the parts of a…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: 3. Which of the following two molecules of DNA melts (into single strands) at a lower temperature…
A: Melting of double-stranded DNA into single strands depends on the GC content of DNA that is number…
Q: When double-stranded DNA is heated at neutral pH, which change does not occur? O The N-glycosidic…
A: DNA is the genetic hereditary material found in almost all organisms. All cells in our body contain…
Q: 2. Another kind of mutation is the so-called frameshift mutation, caused by an insertion or a…
A: Frame shift mutation occurring due to insertion or deletion of single nucleotide will lead to shift…
Q: 1. Last the 3 parts of a DNA nucleotide 2. List the 3 parts of an RNA nucleotide 3. List the 4 DNA…
A: "Since you have asked multiple questions, according to Bartleby's guidelines, we are only eligible…
Q: 1. What is the difference between a nucleotide and a nucleoside? Explain by giving an example, using…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1. How does the DNA structure reflect its functions? 2. What are the important features of the DNA…
A: The DNA molecule is made up of two strands that form a double helix shape as they coil around one…
Q: ider the structure and function of DNA. Which of the following statements is TRUE? O Because DNA…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: How many different bases are found in DNA
A: DNA is the genetic material in the majority of the living species. Deoxyribonucleic acid is made of…
Q: If one of the strands in DNA is made up of 10% guanine, what will be the composition of the DNA? A.…
A: The base complementarity of DNA is defined by the Erwin Chragff rule. Which states that in DNA there…
Q: 2. The percentage composition of a nucleic acid molecule found in bacterial cells is 32.3% adenine,…
A: Nucleic acids are polymers whose monomeric units are called nucleotides. Nucleotides have three…
Q: 1. Where is DNA found in the cell? DNA in the cell is found in the nucleus 2. How does 2m of DNA fit…
A: According to bartleby expert guidelines, when multiple questions are posted we are allowed to answer…
Q: The two strands of DNA that make up the double helix are held to each other by ... a) hydrogen bonds…
A: DNA is made up of nucleotides which contains three parts: a sugar molecule (deoxyribose), phosphate…
Q: A scientist discovers an unknown nucleic acid, they analyze it chemically and discover the…
A: DNA is a double stranded molecule which is responsible for storage and transmission of genetic…
Q: 1. Name the bonds that help to hold the two DNA strands together. 2. Name the three-dimensional…
A: 1) Hydrogen bonding 2) Double helix 3) 12 4) Complementary
Q: 4. The newly synthesized DNA strand during replication was made from the 5' to 3' direction. 5. The…
A:
Q: nucleic acid. b) . What is/are the major chemical difference(s) between RNA and DNA?
A: It is the question about nucleic acid i. DNA and RNA. Both DNA and RNA are nucleic acid but though…
Q: Enzymes that break down DNA catalyze the hydrolysis of the covalent bonds that join nucleotides…
A: DNA is long polymeric chain with simpler units called nucleotides. The backbone of DNA is made up of…
Q: If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 9.)Which of the following does NOT describe the molecular structure of (DNA) Deoxyribonucleic Acid?…
A: 9- DNA is a double helix ,deoxyribose sugar made up of nitrogenous bases while RNA is ribose sugar.…
Q: 1. Write out the full name for DNA. 2. What is a gene? 3. Where in the cell are chromosomes located?…
A: DNA is the basic genetic and hereditary material in most eukaryotic organisms. It is a nucleic acid.…
Q: 7. (leading or lagging?) 6. (which enzyme joins the nick?) 5. 4. 3. (which enzyme?) 8. (which end 5'…
A: DNA replication of one helix of DNA results in two identical helices. Enzyme helix helps to unwind…
Q: 2. What shape/structure is DNA often described as? *
A: DNA is a nucleic acid present in the nucleus of eukaryotic cells. DNA is composed of many monomer…
Q: 1. Nucleotides make up DNA. List the three parts of a nucleotide. The three parts of a nucleotide…
A: As per our policy, We are answering only question 1. For the rest of the questions please repost.…
Q: 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each…
A: A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. A nucleotide is a…
Q: 2. The organization of DNA requires that replication be performed by a large “machine of proteins."…
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: Describe the structure of DNA. The two strands of DNA are antiparallel. What does the term…
A: DNA contains all organism's order for growth, survival, and reproduction. DNA sequences must be…
Q: 1. Which shows the correct complementary base pairing for DNA? a C-A, T-G b. C-G, U-A c. A-G, C-T d.…
A: The thread-like structure that consists of the genetic information of the organism, located within…
Q: 1. When you simply look at the banding patterns on the gel from the DNA fingerprint we ran in lab as…
A: Gel electrophoresis is a molecular biology technique that is used commonly after DNA isolation to…
Q: Mention and explain 4 characteristics of the Structure of DNA.
A: DNA- Deoxyribose Nucleic Acid
Q: Calculate the weight in grams of a double-helical DNA molecule stretching from Earth to the moon…
A: The term double helix refers to the structure formed by double stranded molecules of nucleic acids…
Q: When DNA replicates, how is it able to “unwind” its double helix?
A: DNA is able to unwind it's double helix with the help of enzyme DNA Helicase.
Q: Which of the following statements is true about DNA? Select one: O a. The two strands of DNA are…
A: The DNA molecule is a polymer of nucleotides. Each nucleotide is composed of a nitrogenous base, a…
Q: The DNA helix is stabilized by I. hydrogen bonds between primary amine groups and keto groups II.…
A: DNA is a double-stranded nucleic acid present within the nucleus of the cell. The double-helical…
Q: 1. A space probe returns from Jupiter and brings a new microorganism for study. It has a…
A: As we already know that in double stranded DNA replication is semi-conservative and discontinuous…
Q: 1. Directly below the DNA nucleotide sequence given below, write/type the complementary nucleotide…
A: 1. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: 8. Which of the following diagrams best illustrates a DNA molecule? R R R CH, O H H3C CH3 H CH, O ||…
A: Genetics is the branch of biology that deals with genetic material like DNA, RNA, inheritance.…
Q: b. What is the difference between the 3' and the 5' ends of a nucleotide chain? C. Do the chains run…
A: The double stranded helical structure of DNA (deoxyribonucleic acid) was first demonstrated by James…
Q: 7. What are the 4 nitrogen bases? 1. 2. 3. 4. 8. What is their purpose? Why does their order matter?…
A: DNA is a polymer of nucleotide. One nucleotide is made up of one nitrogenous base, one phosphate and…
Q: 1. Two chains of DNA must run in directions and must be bond to each other. a. Opposite,…
A: Introduction DNA Is The Chemical Name For The Molecule In All Living Things That Conveys Genetic…
Q: 4). A scientist analyzed a segment of 1 point DNA from a human chromosome and found that the…
A: The correct answer is (c) Row 3
Q: describe/s the statement. _(1) Are the basic structural unit of DNA and RNA. It consists 3., of 4…
A: INTRODUCTION DNA( Deoxyribonucleic acid ) and RNA ( Ribonucleic acid ) are two types of nucleic…
Q: One strand of a DNA molecule has the base sequence CCATTG. What is the base sequence for the…
A: Chargaff’s rule of DNA base pairing: Chargaff’s rule states that number of purines and pyrimidines…
Q: 1. What are the common parts of the nucleotide? 2. Name the different kinds of nitrogenous bases…
A: A nucleotide is made up of three parts: 1.phosphate group, 2. 5-carbon sugar, 3.Nitogenous base…
Q: 1.What are nucleic acids? What are their functions? 2.Illustrate and compare the primary and…
A: Nucleic acids are one of the biomolecules that are important for the carrying of genetic information…
Q: 2. Manufacturing biological molecules in the laboratory requires the use of relatively pure…
A: In a cellular compartment, the synthesis of biological molecules takes place in a series of steps…
1. When
2. Instead of the term “Formation of a nucleoside”, what could the name of the reaction be? What
3. Define the primary structure of DNA/RNA. Compare and contrast to the primary structure of proteins.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 1. If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary strand? 2. When DNA replicates, how is it able to “unwind” its double helix? 3. What are the types and major functions for each type of RNA?1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.5. Know the enzymes involved in DNA replication, and predict the result of their malfunctioning. PART 1: DNA STRUCTURE Nucleotides are the building blocks of nucleic acids (RNA and DNA). 1. On the nucleotide schematic below: A. label the phosphate group, the nitrogenous base, and the pentose (5-carbon sugar). B. Label the carbon atoms in the sugar ring from 1 to 5. 0-²-0-²-0-- hon t ori s H I. -H N 'N od isnw begee 976 eb H 10 BA C. What functional groups on ANY nucleotide can tell you whether it is a component of DNA or RNA? D. Which carbon # is this functional group bound to? E. What functional group does the 3' on DNA represent? F. What functional group does the 5' on DNA represent? 18 47
- 4. The base content of a particular DNA molecule is 24% G. What is the percentage of the following bases in the molecule? %A: 5. What is the structural difference between the pentose sugars in DNA and RNA? % T: % C: 6. Why is the AT base pair less stable than the GC base pair?32. Would you expect to find hydrophobic amino acids on the external surface or internally in proteins? Why? 33. What is required for molecular surfaces/interfaces to interact with one another for a sufficient amount of time (such as an antibody/antigen)? many intermearat only partially replicated. Thus, Meselson and Stahl's experiments showed that DNA replication IS a semiconservative process in which the single strands of the double helix remain intact (are conserved) during a replication process that distributes one parental strand into each of the two daughter molecules (thus the te uonry NOTES3. Consider the following diagrams representing three different DNA molecules. (a) 5' 3 3' 5' (b) 5' 3' 5' (c) 3' 5' Assuming that DNA polymerase is the only enzyme present and that there is no additional DNA, state whether each of these (= molecules can serve as a substrate for DNA synthesis. Give reasons as to why or why not.
- Why are nucleobases in nucleic acids called "bases"? 1. Because they resemble baseball bases 2. They are fundamental to "hodling up" the DNA structure (like the base of a building holds up the rest of the building) 3. They are the "command center" of the cell. Like the "base" of operations for armed forces in a war. 4. They are hydrogen ion acceptors, like other chemical bases7. What are the 4 nitrogen bases? 1. 2. 3. 4. 8. What is their purpose? Why does their order matter? Answer in complete sentences. How does this structure allow a DNA molecule to be copied to make another identical molecule? The answer to this question is that the nitrogen bases interact with one another in predictable ways. Pairing between nitrogen bases on opposite strands is always the same. Notice that the pairing that takes place between nitrogen bases is specific in DNA strands. Adenine, a large base, bonds with thymine, a small base. Guanine, a large base, bonds with cytosine, a small base. This specific bonding pattern that happens between the nucleotides is called complementary base pairing. 9. How do the bases pair? How are A and G similar? How are T and C similar?II. Phoebus Levene (1920s) He is perhaps best known for his incorrect tetranucleotide hypothesis of DNA (DNA was made up of equal amounts of adenine, guanine, cytosine and thymine). He did, however, work to determine the chemical structures of many biochemicals. Specifically, he chemically analyzed DNA and stated it consisted of 3 parts. 2. What are the 3 parts of a nucleotide?
- 1. discuss the effect of temperature on the viscosity of the liquid 2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?2. Suppose the following base sequence was found in a 20-base DNA polymer. C-A-G-T-T-A-A-G-G-T-C-C-T-A-G-G-T-T a. What would be the bases in the complementary strand of DNA? b. What would be the mRNA strand transcribed? c. What would be the corresponding tRNA anticodons? d. What are the amino acids coded by the transcribed mRNA?3. For this short DNA segment, a. identify the 5' end and the 3' end of the molecule. b. circle the atoms that comprise the backbone of the nucleic acid chain. c. write the nucleotide sequence of this DNA segment. P-OCH, CH, HN OP-OCH, NH, OCH, OH 4. A DNA strand has the sequence ATGGCAATCCTCAAACGCTGT a. What is the sequence of the complementary DNA strand? b. What is the sequence of the mRNA that would be produced during transcription from the original strand of DNA? 5. Write the codon on mRNA that would pair with each tRNA anticodon. a. UUG b. GAA c. UCC d. CAC