Number 1 1. Directly below the DNA nucleotide sequence given below, write/type the complementarynucleotide sequence of the new DNA strand that would be synthesized during DNA replicationusing this given DNA strand as the template strand (Ilabel both ends of the new DNA strand)Which direction would this synthesis occur in: left to right? or right to left? (or use an arrow toshow the direction) 1. Directly below the DNA nucleotide sequence given below, write/type the complementarynucleotide sequence of the new DNA strand that would be synthesized during DNA replicationusing this given DNA strand as the template strand (label both ends of the new DNA strand)Which direction would this synthesis occur in: left to right? or right to left? (or use an arrow toshow the direction)2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotidesequence of the mRNA strand that would be transcribed using the new complementary DNAstrand as the template (label both ends of the new mRNA strand). Which direction would thissynthesis occur in: left to right? or right to left? (or use an arrow to show the direction)3. Finally, directly below the mRNA sequence that you wrote for #2, write the amino acidsequence of the polypeptide that would be translated using the new mRNA sequence as thetemplate (label both ends of the polypeptide sequence). Do this as a ribosome would in thecell. Which direction would this synthesis occur in: left to right? or right to left? (or use anarrow to show the direction)5'-CTATGTTAGAGTATTGCGA CTGAAGG-3'

Name: Number 1 1. Directly below the DNA nucleotide sequence given below, wr
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Number 1 1. Directly below the DNA nucleotide sequence given below, write/type the complementarynucleotide sequence of the new DNA strand that would be synthesized during DNA replicationusing this given DNA strand as the template strand (Ilabel both

1. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Science

Biology

1. Directly below the DNA nucleotide sequence given below, write/type the complementary nucleotide sequence of the new DNA strand that would be synthesized during DNA replication using this given DNA strand as the template strand (Ilabel both ends of the new DNA strand) Which direction would this synthesis occur in: left to right? or right to left? (or use an arrow to show the direction)

1. Directly below the DNA nucleotide sequence given below, write/type the complementary nucleotide sequence of the new DNA strand that would be synthesized during DNA replication using this given DNA strand as the template strand (Ilabel both ends of the new DNA strand) Which direction would this synthesis occur in: left to right? or right to left? (or use an arrow to show the direction)

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 2VCQ: Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and...

See similar textbooks

Similar questions

1. Draw a DNA helix opened up to copy a single gene (CAREFUL this is NOT a replication bubble). You can make lines straight and parallel if you would like 2. On the bottom strand starting in middle and pointing to the left, draw a 90 degree arrow to show the start of transcription. 3. Add 10 DNA bases of your choice (A,T, C or G) along the bottom line to left of the 90 degree arrow. 4. Add the complementary DNA bases along the top line. 5. Beginning at the 90 degree arrow, transcribe the DNA into RNA. Write the appropriate letters. Label this as mRNA 6. Label 5' and 3' ends of all nucleic acids. 7. Label the template strand and the coding strands of DNA. 8. Label the promoter. (Upload steps 1-8 but on your own please practice all 4 possible flips of this. Arrow on bottom facing left or right. Arrow on top facing left or right.)
What does i mean to say that extension by DNA polymerase III proceeds 5' 3'? The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. DNA polymerase adds nucleotides to a growing strand, moving in the 5'-3' direction. O DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA. O O 0
For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand.
I. What is the correct order of enzyme action during DNA replication? Number the steps from 1 to 7. HINT: Refer to the slide show and video lecture on this topic to help you solve this one: Synthesis of RNA primers (priming) Ligation II. A double-stranded DNA molecule with the sequence shown below can produce a polypeptide that is four amino acids long. Identify which DNA strands are the coding and the transcribed template strands by circling C or T to the left of the table below, respectively. Use an arrow to indicate the direction of transcription. In the table, show the mRNA sequences and amino acids in this peptide. In spaces to the left and right of the table, label all 5' and 3' ends of all relevant nucleic acid strands. READ CAREFULLY: The table gives you the possibility of filling in answers that show transcription from either strand or in either direction. You are only required to fill in the information relevant to ONE PEPTIDE (no others). Refer to the genetic code on the…
2. For the DNA molecule shown below, the 5' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) DNA 5'GCTTGATCAGCTAGTCCATC GATCGGTCCTCGGAGCCCATTAAGGTAGC 3' DNA 5' 3'CGAACTAGTCGATCAGGTAGCTAGCCAGGAGCCTCGGGTAATTCCATCG mRNA 5' Protein Alanine Arginine Aspartic Acid ASP Asparagine ASN Cysteine CYS Glycine Glutamic Acid GLU Glutamine Histidine Isoleucine Leucine Lysine ALA Proline Serine ARG GLY GLN HIS ARDNUGEO H А с ISE I LEU L LYS K Methionine MET M Phenylalanine PHE F PRO P Tyrosine Tryptophan TRP Valine VAL SER S Threonine THR T TYR Y <हर First letter UUU Phenyl- UUC alanine G UUA UUG CUU CUC CUA CUG A AUA AUG AUU AUC Isoleucine GUU GUC Leucine GUA GUG Leucine Methionine; start codon Valine UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter Serine Proline…
Below is a picture of a single origin of replication in a eukaryotic cell. 5' 3' 5' 1. On the figure above, Draw out where the following molecules will be located: Helicase; Sliding Clamp, Single Strand Binding Protein. 2. On the right hand side of the dotted line, the replication of which template strand (top or bottom) will be continuous by DNA polymerase? 3. On the left hand side of the dotted line, the complete replication of which template strand (top or bottom) will be more affected by a mutation that causes DNA ligase to be partially functional?
1. For each of the items below, give a brief description (indicate function for enzymes) and indicate in which process (replication, transcription, or translation) it is involved with. Description/Funetion catalyzes the unwinding of DNA strands Process involved in helicase replication 1. RNA primer 2. leading strand 3. RNASE 4. anti-sense strand 5. anticodon 6. RNA polymerase II 7. DNA polymerase 8. promoter site 9. DNA ligase 10. exit site
1. make your own sample representation of DNA replication. Complete your representation for a single helical turn. 2. prepare a representation of how mRNA is formed in the nucleus 3. Complete to build a Polypeptide. Start from the DNA template you made , the mRNA transcript formed, and finally the processed or synthesize proteins with the aid of the Genetic code table.
2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 1) САСТС ССAGT GTACC T 3) GGAGT CAATC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TACCT GCA 11) TGCAA GCCGA G 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GСТTG G 12) TGCTT GGAGT (a) Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…
Match the following descriptions with the enzymes involved in DNA replication. 1. Adds an RNA primer to begin elongation 2. Removes the RNA primer from the beginning of the newly constructed strands 3. Splices lagging strand segments 4. Cleaves the rung of the DNA double helix ladder Description: DNA DNA Helicase Primase Enzyme: Polymerase Ligase
1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
1. For the DNA molecule shown below, the 3' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) TAAGCTAG3' DNA 5'GAGATCGATGTCCATCGATCGATCGAATTCGGAGCCAATT DNA 3'CT CTAGCTACAGGTAGCTAGCTAGCTTAAGCCTCGG TTAAATTCGATC 5' mRNA 5' Protein