Answered: Determine the sequence of the mRNA…

Name: Give correct detailed Solution with explanation needed...don't give Ha
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give correct detailed Solution with explanation needed...don't give Handwritten answer..don't use Ai for answering this. Don't copy answer anywhere Determine the sequence of the mRNA strand.OrgininalDNA:mRNATQuestion 2/2helicaseribosomesCDNA polymera

Science

Biology

Determine the sequence of the mRNA strand. Orgininal DNA: mRNA T Question 2/2 C G G T Which enzyme is responsible for the unwinding the DNA double helix in transcription? T A

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 4SQ

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Name of the enzyme that adds RNA Nucleotides during Transcription? O Helicase O Primase DNA Polymerase O RNA Polymerase 9MD
oslorGulolaculGACu When does DNA replication occur in the cell cycle? Replicate this strand of DNA: ATTCGC TAG GU Aanine Transcribe the same piece of DNA Stop GU Valine Cystelne Stop Use the chart to create the amino acid sequence. Arginine AC Leucine Sorine C UG Lysine Proline Define gene mutation Asparagine True or False? All mutations are harmful. Define chromosomal mutation. Histidine Threonine
E The arrow in the diagram below indicates the direction of transcription. BTTL c. A ATGCCGCA AUGCCCCAAUCUG TACGGCGTTAGAC OA OB с Q Search Which letter indicates the 5' end of the DNA template strand? R F TTCACGCACTCATSTOFACCACGTA T G Direction of synthesis- CG STACATGAGIAC LOC Y H Krit & 7 FO U 99+ * 8 D ATEGTGCAT CVBNM MO DE 79 Alt F:-10 KL E 0 P ^ @ ¹ F12 Ctrl 10:37 AM 4/8/2023 10
Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…
RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||
Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the nucleotide sequence of the DNA strand complemantary to sequence given above B Give the sequence of nucleotide in the Mrna that would be synthesized if the complementary strand in the answer above is used as a template during transcription
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
Replication vs transcription Uses DNA as template to synthesis a polymer Synthesizes DNA strand(s) Forms phosphodiester bonds Requires a primer Low capacity for proofreading Works in conjunction with other proteins Faster More error prone DNA polymerase III RNA polymerase Transcription mRNA transcripts code for multiple genes Multiple types of RNA polymerase Create mRNA transcript from DNA Transcription in cytoplasm Pribnow box in promoter TATA box in promoter Untranslated regions (UTRs) Post translational modification Prokaryotes Eukaryotes
He sequence is read A DNA sequence before and after replication IS 3 from left to right. The table below shows which mRNA codons code for each type of amino acid. Second mRNA base с U A G DNA sequence before replication: TACCTAGCT UUC - Phe UCC - U UUU- Phe UCU - Ser UAU - Tyr UGU - Cys Ser UAC - Tyr UGC-Cys C UUA - Leu UCA - Ser UAA- Stop UGA - Stop A Leu UCG - Ser UAG - Stop UGG- Trp G Pro CAU - His CGU - Arg U - Pro CAC- His CGC - Arg C DNA sequence after replication: TACCTCGCT UUG Leu CCU CUU CUC Leu CCC CUA- Leu CCA- Pro CAA Gln | CGA- Arg A - Pro CAG - Gln CGG- Arg G AGU- Ser U AGC - Ser C CUG Leu CCG AUU AUC Lys AGA- Arg AGG- Ile ACU Thr AAU - Asn Ile ACC - Thr AAC - Asn ACA - Thr| AAA - ACG - Thr AAG - Lys GCU - Ala GCC - Ala Arg A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes the result of the mutation when the corresponding mRNA sequence is translated? GAU- Asp AUA Ile AUG- Met GUU - Val GUC - Val Val Val GCG - Ala GAC - Asp…
Original DNA 3'TAC ACC TTG GCG ACG ACT'S sequence: MRNA transcript: amino acids: Is the "original DNA sequence" above a coding or a template sequence?
Complete the complementary strand: mRNA transcription ATTCGAGGCTAA