Below is a diagram of an Oscar Miller (Christmas tree) spread. Which of the following is true? O a. this represented the first example in eukaryotes in which translation was visualized with the electron microscope Ob.each "Christmas tree" represents the transcription of a single type of rRNA (i.e. 28S or 18S or 5.8S) O c. as drawn, transcription is proceeding from left to right O d. three nucleolar organizer regions are shown

Below is a diagram of an Oscar Miller (Christmas tree) spread. Which of the following is true? O a. this represented the first example in eukaryotes in which translation was visualized with the electron microscope Ob.each "Christmas tree" represents the transcription of a single type of rRNA (i.e. 28S or 18S or 5.8S) O c. as drawn, transcription is proceeding from left to right O d. three nucleolar organizer regions are shown

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
Following is an mRNA sequence reported in data base.5’ ACC AGA ATG ACC ATG GCA 3’ a) There are two ATG’s. From which the translation can be initiated.i. 1st ATGii. 2nd ATGiii. Noneb) If there are multiple possible start codons, how can you identify the original start codon? Explain.
This is the sense strand of a mammalian gene. Determine the sequence of the mature mRNA. Assume transcription starts approxiamtely 25 bp downstreams from the TATAAT box, that the 5' splice site is AG/GUAAGU and that the 3' splice site is AG\GN. / marks the 5' splice site and \ marks the 3' splice site. N means any nucleotide. (In this problem, there are no branch point A's or polyY tracts. Please mark the splice sites as defined above. (5'=/ and 3'=\) and underline the mature mRNA. Do not use alternate splicing. TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGT ATGATAGGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATAATTAAGCACAGGCATGCA GGGATATCCTCCAAATAGGTAAGTAACCTTACGGTCAATTAATTAGGCAGTAGATGAATAAACGATAT CGATCGGTTAGGTAAGTCTGAT
The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′ triphosphate linkage, and by methylation at the 2'-hydroxyl of the penultimate nucleoside. What cofactors involved in the capping reaction
Given the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letter
Pre-MRNA A/C A G GU AG A GU CU A/G A C/U NC AG G Frequency of occurrence (%) 70 60 80 100 100 95 70 80 45 80 90 80 100 80 80 100 100 60 15-45 bases In Figure 8-15, what do you think would be the effect of a A to G mutation in the branch point residue of the intron? (Two answers.) The U5 snRNP would bind to the A that is now the first residue of the intron, and splicing would proceed normally. The U1 snRNP would be unable to bind to the intron, which would prevent intron splicing from occurring. The U1 snRNP would might find a nearby GU and use that for splicing, which would allow splicing to occur but would have consequences on translation. The U2 snRNP would be unable to bind to the branch point, which would prevent intron splicing from occurring. The U2 snRNP might find another nearby A and use that for the branch point, which might allow normal intron splicing. The hydroxyl from the branch point A would be unable to complete its transesterification reaction, and intron splicing…
The following DNA strand is a template strand (also called non-coding strand) of an E. coli gene. Arrow indicates the direction of transcription. The asterisk indicates t transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' GCAGTGA 3' -10 Which of the following sequences accurately represents the RNA derived from this gene? C5' UCCUUAC 3' C3' UCCUUAC 5' C5' CGUCACU 3' +10 3' AGGAATG 5'
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Below is a segment of DNA that depicts an entire gene. Please match the letter to the correct gene elements. A B C D E F 3' ||||| A C D ✓ [Choose ] control elements +1 site holoenzyme sigma factor 3' UTR E apoenzyme 5' UTR coding region RNA polymerase promoter consensus sequence [Choose ] B F A 5'
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'