RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TACGG TTAGACAAG GCGTGAGTACACA ATGCC CAATCTGTTCACGCACTCATGTGT
Q: A group of people are studiedd with made up blood types AZ blood group which is a blood type…
A: The Hardy-Weinberg equilibrium is a principle in population genetics that describes the relationship…
Q: Correctly label the components of the lungs. Costal surface Horizontal fissure Superior lobar…
A: The lungs are a pair of spongy organs located in the chest that play a critical role in respiration.…
Q: In the Avery, McLeod, McCarty Experiment where supernatant from heat killed, virulent S Strain…
A: In this talk, we will learn about a very important experiment called the Avery, McLeod, and McCarty…
Q: You take a walk in Forest Park (Portland, OR) and see a sword fern growing along the trail. You are…
A: Alternation of generation is a process that occurs when an organism alternates between sexual and…
Q: A dihybrid cross SS tt x ss TT is used to make an F₁ generation. In the cross the S locus exhibits…
A: Gregor Mendel is regarded as the father of genetics. His experiments with pea plants in the…
Q: In the case of a protein suspension, which of the following statement/s is/are TRUE? I. The smaller…
A: Gel exclusion chromatography is a low resolution isolation technique that makes use of a neat…
Q: Many of the physiological systems that we have discussed this semester have some component that…
A: Adenosine triphosphate (ATP) is a molecule found in all living cells that carries chemical energy…
Q: Quick question on the process of movement Multiple sclerosis is a disease in which the…
A: Multiple sclerosis (MS) is a chronic disease of the central nervous system (CNS) that damages the…
Q: image of what a CT scan of an animal skull looks like
A: Computed tomography (CT) checks are an progressed imaging method utilized in veterinary medication…
Q: The table describes the characteristics of a given location. Characteristic Description Average…
A: A biome is a significant natural region on Earth that is distinguished by a unique flora, fauna, and…
Q: What is different about the behavior of the external urinary sphincter from most other voluntary…
A: The external urinary sphincter is a unique voluntary muscle in that it is under both voluntary and…
Q: Which of the following statements are correct for RNA viruses? Mark all that apply. A.Replication…
A: RNA viruses are a type of virus that have RNA (ribonucleic acid) as their genetic material instead…
Q: Which of the following statements about nucleic acids is not correct? Select one: A. In DNA the…
A: Nucleic acid is a genetic material. It controls all activities of the cell. DNA and RNA are examples…
Q: 7. Which advantage of living in a social group is depicted below? fety in numbers se of finding a…
A: Aggregation refers to a gathering of fish that is not well-organized and often includes multiple…
Q: Brood parasitism is considered altruistic because the “parasite”? Manipulates the host parent into…
A: Parasitism is a type of interaction in which one organism gets proper benefit whereas another…
Q: Briefly describe the role of BMP-4 in ovarian follicular development
A: Ovarian follicular development is a complex process involving the growth and maturation of follicles…
Q: 5. How is the primary response different from the secondary response?
A: The capacity of an organism to fend off or resist disease- or infection causing agents like…
Q: When you are fed, your pancreas releases short- and long-term storage for later use. Glucagon…
A: Your body uses hormones as chemical messengers. They move to tissues or organs through your…
Q: Large intestine Stomach Jejunum lleal papilla Appendix Duodenum lleum Reset Zoom 50
A: The image shows parts of alimentary canal in the form of small intestine and large intestine. Small…
Q: What would the most likely genotype be for a person exhibiting a rare single gene Autosomal…
A: Mutations in genes situated on autosomes, which are non-sex chromosomes, cause autosomal recessive…
Q: Kindly submit a narrative report of your journey in making your compost/compost pit plant atleast…
A: To use the items in your refrigerator which are a bit beyond their prime and prevent food waste,…
Q: F in this picture represents female . C = Children. And M = man. The arrow marked at number 1…
A: A laboratory technique called DNA fingerprinting uses a sample of DNA to identify a person by…
Q: The respiratory mucosa of the upper airway is composed of … A) dense irregular connective…
A: The respiratory mucosa is a specialized lining that covers the respiratory tract, from the nasal…
Q: A population of lizards colonizes a region and feeds on small arthropod species. Over time, a small…
A: Speciation is the process through which new species emerge from the existing ones. Speciation may…
Q: Give typed explanation Leptin is an adipocyte hormone that sends signals to the brain to “eat…
A: Leptin is a hormone that plays a key role in regulating body weight by suppressing appetite and…
Q: 6. Describe how a cytotoxic T-cell interacts with antigen presented in MHC I. Describe how a helper…
A: The immune system's adaptive response involves specialized cells called T-cells, which recognize and…
Q: need help with both parts pleae
A: The given question states about graphical representation and datas provided for hormonal regulation…
Q: Do cells make accurate copies of DNA? Explain with the help of a diagram
A: DNA replication is the process by which a cell makes an identical copy of its DNA. It is a…
Q: Provide examples of negative and positive feedback in the regulation of the ovulatory cycle.
A: The rhythmic monthly cycle of hormones and changes in the ovaries and uterus of the females is…
Q: B cell-receptors differ from T cell-receptors in that ________. A) B cell-receptors are…
A: B cells & T cells are two types of lymphocytes involved in the adaptive immune response. Both of…
Q: We learned about a lot of species of mammals with heterodont dentition. However, some mammals are…
A: Mammals are a diverse group of animals that exhibit a wide range of dental characteristics. While…
Q: Question 19 What determines the sex of a child? the sex chromosome in the sperm the sex chromosome…
A: Answer is 1 Sex of a child determines by the sex chromosome in the sperm. Because the sperm…
Q: In your own words, briefly describe the function of FeSO4 in the KIA medium in one sentence.
A: KIA (Kligler Iron Agar) medium is a differential and selective medium used in microbiology to…
Q: Describe the hormonal regulation of folliculogenesis.
A: Folliculogenesis is the process through which follicles in the ovary grow and ultimately produce a…
Q: Parkinson's disease is linked to destruction of the caudate and putamen. extensive death of neurons…
A: Parkinson's disease is a chronic and progressive neurological disorder that affects the central…
Q: What is the one-letter amino acid sequence formed from the following mRNA that codes for a…
A: Nucleic acid is a macromolecule which play important role in storage of genetic material and…
Q: what are the benefits of scoring a 9mm skinfold calliper test in sports
A: The 9mm skinfold calliper test is an easy, non-invasive way to determine composition of subcutaneous…
Q: Carotid Sinus Massage is used as a clinical tool in the diagnosis of certain cardiovascular…
A: The carotid sinus reflex is a physiological mechanism that helps to regulate blood pressure. The…
Q: Elevated levels of this hormone promote seed dormancy? Select one: a. gibberellin b. abscisic acid…
A: Plant hormones These organic molecules also called phytohormones are responsible for regulating the…
Q: Lilliputian is a term that comes from Book 1 of Gulliver's Travels. It means ..... inferior…
A: Lemuel Gulliver is the protagonist and narrator of Jonathan Swifts famous novel, "Gulliver's…
Q: This is a pedigree for a rare inherited disorder. What is the most likely mode of inheritance? I II…
A: Inherited disorder are caused by changes in certain genes or chromosomes that are transmitted from…
Q: The limbic system is composed of several interconnected structures including the olfactory bulbs,…
A: Alzheimer's Disease is a progressive brain disorder that affects memory, thinking, and behavior. It…
Q: Enough of a monoprotic acid is dissolved in water to produce a 1.83 M solution. The pH of the…
A: First, the pH can be used to determine the amount of H+ ions present in the solution:…
Q: In this DNA replication bubble, label the 5' and 3' ends of each of the two parent strands (labeled…
A: DNA replication is the process of producing two identical replicas of a DNA from one original DNA…
Q: Yeast cells are added to a 3.0 L batch bioreactor so that the initial cell concentration is [X]. =…
A: In this problem, we have a batch bioreactor containing yeast cells, ribose, and ammonia. The goal is…
Q: 6. The following diagram shows a replication bubble within a double stranded DNA molecule. The red…
A: Replication is the first and foremost step of the three steps of central dogma in gene expression.…
Q: based on Harding-Weinberg Equation and the allele frequency table below, what is the frquency of the…
A: In a population, the relationship between genotype and the frequency of alleles is described by the…
Q: What is the equilibrium potential of chloride for a typical neuron? We will use the following ion…
A: Equilibrium potential is the theoretical electrical potential difference that exactly balances an…
Q: 5 2 4 3
A: Nervous system: It coordinates and controls the activities of animals and organisms. The central…
Q: 10. The variable region of an antibody a) Binds to a specific epitope on an antigen. b) Can bind to…
A: Memory cells are a type of immune cell that are involved in the long-term response of the immune…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
- mRNA sequence of A gene Find 5’ UTR and 3’UTR of mRNA 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’Question 6 Review after transcription modification. Match the term and its description. Each term can only be used once. catalytic RNA molecules that function as enzymes | Choose ) Some genes can encode more than one kind of polypeptide, depending on which segments are treated as exons during splicing [ Choose ) Proteins often have a modular architecture consisting of discrete regions | Choose J >Template strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)
- 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
- For the tRNA below, determine which amino acid it is charged with. attached amino acid G G GA 5' end c GOGGAUUU CUC G GAGC G C GCSAK & A 3' end ASSAGGCUUAA GACAC CCUGUG עכטט A GAAD anticodon C T U anticodon loop A GDNA MANNMANN B) mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature mRNA b mRNA Cell membrane You are trying to explain to your classmate how DNA is used to make proteins. What should you include explanation? Select ALL that apply. During translation, the genetic code in mRNA is read and used to put amino acids in place to make a protein. During transcription, the genetic code in mRNA is read and used to put nucleotides in place to make a protein.Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′