Choose from : insertion with frameshit, deletion with frameshift, silent mutation, deletion without frameshift, missense mutation, insertion without frameshift, nonsense mutation The wildtype sequence of a gene is the following: wt: 3' TAC AAA TCT AGC CCG 5' and the following 3 mutations were found:, indicate what type of mutation this is 1: 3' TAC AAA TCA AGC CCG 5' ; 2. 3' TAC AAA TCT ATC CCG 5'. ; 3. 3' TAC AAA AGC CCG 5'.

Choose from : insertion with frameshit, deletion with frameshift, silent mutation, deletion without frameshift, missense mutation, insertion without frameshift, nonsense mutation The wildtype sequence of a gene is the following: wt: 3' TAC AAA TCT AGC CCG 5' and the following 3 mutations were found:, indicate what type of mutation this is 1: 3' TAC AAA TCA AGC CCG 5' ; 2. 3' TAC AAA TCT ATC CCG 5'. ; 3. 3' TAC AAA AGC CCG 5'.

Name: Choose from : insertion with frameshit, deletion with frameshift, sile
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Choose from : insertion with frameshit, deletion with frameshift, silent mutation, deletion without frameshift, missense mutation, insertion without frameshift, nonsense mutation The wildtype sequence of a gene is the following:wt: 3' TAC AA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’
The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. help
What type of mutation is shown below: CGG GGG GAG TCT TTT TAT GCA GCT changes to: CGG GGG GAG CTT TTTATG CAG CT A frame shift mutatuion which resulted from a deletion. O Point mutation in which one nucleotide was changed. O Point mutation in which a length of nucleotides were changed. O A frame shift mutatuion which resulted from an insertion.
A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertion
Give 1 example of diseases arising from each of the following mutations and explain each. Point mutation Frameshift mutation Calculate for the DNA concentration. The absorbance at 260 nm is 0.7 at 1:30 dilution; the absorbance at 320 nm is 0.1. Is the DNA isolated of good quality? The absorbance at 260 nm is 0.7; the absorbance at 280 nm is 0.1; the absorbance at 320 is 0.01. If you do an absorbance reading after plasmid purification and get an A260/A280 of less than 1.8, how could you further purify the sample to get rid of the protein contamination? Is it always necessary to have completely pure DNA? What are some cases where it would or would not be?
You have a patient in your clinic presenting symptoms of cystic fibrosis. You screen their CFTR gene for mutations, and find the following list: CFTR 320 L V CFTR 341 S W CFTR 528 E D CFTR 976 F Q CFTR 1235 S R Which mutation(s) are likely causing cystic fibrosis in this patient? You also sequence a newborn family member of this patient. They have all of these same mutations, other than the one at position 976, and no other mutations in CFTR. Do you predict this person will develop cystic fibrosis? Explain why.
EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 1 EboV Strain 1 (Circle the mutated bases) CCA TGT AAG TGG TTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.
EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 2 EboV Strain 2 (Circle the mutated bases) TCA TGT CAG CAA CTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.
A certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibility
Describe the mutation that occurs in the following examples (be specific, if possible): BOAT to BAT SOAP to SOUP PAY to PLAY GCTCT to GCACT TGCCC to TACCC CATGC to GATGC TATATA to TACATA
Identify the type of mutation shown Original Sequence: GGC TAC ATG GAA Mutated Sequence: GGC TAA TGG AA deletion
Below is a portion of an exon from a gene that encodes protein X in the genome of the plant Arabidopsis. Wildtype DNA3’ TTC AAT GCT CCG AAT ACC 5’ template strand5’ AAG TTA CGA GGC TTA TGG 3’ non-template strand A new strain (Strain B) of Arabidopsis is identified with the same region of the gene coding for protein X: 3’ TTC AAT GCT CCC AAT ACC 5’ template strand5’ AAG TTA CGA GGG TTA TGG 3’ non-template strand Compare the two DNA sequences and look for any differences. Based on what you find a. There is no mutation in Strain B compared to Strain A. b. After the point of the mutation, all the amino acids encoded by the Strain B template will be different than the Strain A protein X. c. Protein X made from the Strain B template will be much shorter than protein X made from the Strain A template d. Protein X from Strain B will have one amino acid difference that would not affect protein function. e. There is a mutation but there will not be any difference in the…