Provide the principle of biuret test used to detect RNA. Explain in 5 sentences essay
Q: 5. Arrange the following fatty acids in order from lowest melting point to highest: myristic acid,…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Question 5 An a-helix has the sequence: NH3-Ser-Glu-Gly-Asp-Trp-Gln-Leu-His-Val-Phe-Ala-Lys-Val-Glu-…
A: Alpha helix is a type of secondary structure of proteins. It is the rod-like structure formed when…
Q: The enzyme phosphoglucomutase catalyzes the conversion of glucose 1-phosphate to glucose…
A: Phosphoglucomutase is the enzyme that catalyze the interconversion between glucose 1-phosphate (G1P)…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: The specific activity of a pure preparation of pyruvate kinase (PK) assayed in the direction of…
A: Pyruvate kinase (PK): The role of pyruvate kinase is to catalyze the final phase of glycolysis,…
Q: Explain the regulation of biochemical pathways. Describe the regulation of β-oxidation. Describe the…
A: Beta oxidation is the catabolic pathway of degradation of fatty acids to release energy. Urea cycle…
Q: Select one: O a. will require an input of energy O b. O c. will absorb energy O d. is not a…
A: The Gibbs–Helmholtz equation is a thermodynamic equation which is used calculating changes in the…
Q: 3. Predict the effect of each of the following amino acid substitutions on the KM and keat of the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which of the designations are accurate for the fatty acid?
A: Simple fats or triglycerides are fatty acid esters of glycerol, where three fatty acid molecules are…
Q: 15-24 b) c) Identify the molecules oxidized and reduced in the following reactions: a) CH₂CH₂CHO +…
A: Many redox reactions occur during metabolism. Redox reactions necessitate the transfer or removal of…
Q: Determine whether each of the examples or phrases describes an essential amino acid, a nonessential…
A: INTRODUCTION: They are the building blocks of proteins and amino Group (NH2) and Carboxyl Group…
Q: 1) Find the pH of 0.1 M of the differnet forms histidine species. (See image for equation and pKa…
A: Amino acids are building blocks of the proteins. Alpha carbon of amino acids consist of carboxyl…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: Write a description of the physical characteristics of the isolated starch and glycogen. Provide the…
A: Starch and Glycogen are Polysaccharides, made up of many units of monosacharides. Starch is reserve…
Q: a) This molecule is produced when what amino acid is transaminated? b) What are the one- and…
A: Amino acids are biomolecules in which an amino group and a carboxyl group are linked to the same…
Q: *Complete hydrolysis of glycerophospholipid yields equimolar amounts of glycerol, a fatty acid [16:1…
A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…
Q: create a concept map revolving around the topic nucleic acids. Use at least twelve (12)…
A: Nucleic acids are large biomolecules which plays important role in expression, storage and transfer…
Q: Tumor necrosis factor (TNF) signaling Discuss the nature of the TNF ligand and the receptor for…
A: Cell signaling pathway involves a cascade of reactions inside the cell which is triggered by small…
Q: 2. Draw the structure of the fatty acid, 16:247,10, as it occurs at pH 7. Make sure double bonds…
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Q: This is the ATP accounting question. You are limited to the carbon in the following molecules:…
A: After glucose enters the cell, there are two possible fates it can undergo: enter glycolysis,…
Q: Maargerines made from plant oils are healthier, since they are hydrogenated for spreadability?…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Cytochrome a is a component of: Complex I Complex II Complex III Complex IV
A: Introduction Electron transport chain consists of series of protein complex that transfers electrons…
Q: You want to study a biomolecule in the laboratory. You have ordered the synthetic gene from a…
A: The process by which a specific gene sequence of interest is ligated and then the newly synthesized…
Q: Metabolic Integration Q9.1: Glucose-6-phosphate is a key metabolic intermediate in four major…
A: Glucose-6-phosphate is the key metabolic intermediate where it is branched to four major metabolic…
Q: a) Describe the three irreversible reactions of the Citric Acid Cycle. Ensure to indicate their…
A: Krebs cycle or tricarboxylic acid (TCA) cycle in aerobic organisms is the final stage of catabolism…
Q: What is the overall net reaction of glycolysis? C6H12O6 + 2 NADH + 2 P₁ + 2 ATP --> 2 C3H3O3 + 2…
A: In glycolysis, glucose is oxidized into pyruvate. It involves a series of enzyme-catalyzed…
Q: II. Draw the different forms of the following amino acids in solution. 1. Proline (3 forms) 2.…
A: Amino acids are basic unit of polypeptide chain. Alpha carbon of amino acids contains carboxyl…
Q: Which reaction or reactions of glycolysis require ATP as a reactant? List the enzymes that catalyze…
A: Glycolysis is a catabolic pathway in which glucose is broken down into two molecules of pyruvate to…
Q: The Standard free energy CAG0¹) of the reaction shown above can be estimated based on? A. High…
A: Standard free energy of a reaction (∆Go') is the amount of energy released or consumed in the…
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: II. Draw the different forms of the following amino acids in solution. 1. Proline (3 forms)
A: Since in the question, it is mentioned to write about the 3 forms of proline, only answer to that…
Q: The expresion ytou have like [deprotonate][protonate]. Are they multiplying or dividing? Is not…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: QUESTION: Which of the following statements about Carbohydrates is TRUE? O The human body can…
A: Carbohydrates are one of the important biomolecules. These are also termed as hydrates of carbon.…
Q: You perform a succinate dehydrogenase (SDH) assay on the fractions the isolated fractions. You read…
A: The sixth step of the Tricarboxylic Acid (TCA) cycle is catalyzed by succinate dehydrogenase (SDH).…
Q: You are running a size exclusion column to purify your 25 kDa protein from a lysate mixture. The…
A: Size exclusion column chromatography: As a function of their respective sizes, molecules are…
Q: Briefly and in simple terms, describe the glycoside bond connecting two monosaccharides in a di- or…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: 1) Perform the necessary calculations and fill in the values in the table below (be sure to include…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: true/false: Humans produce isoleucine using pyruvate as a starting material.
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: A researcher found that a single point mutation in the genome of the SARS-CoV-2 virus resulted in a…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Which two statements below accurately describe the roles of insulin and glucagon in maintaining…
A: Glucagon is a hormone secreted by the pancreas that controls the blood glucose level. It prevents…
Q: Calculate and draw the isoelectric point of the tetrapeptide Ser-Leu-Phe-Pro at pH 7.0. hand written…
A: Isoelectric point is the pH at which the positive and negative charges are equal, i.e., the net…
Q: In beta-oxidation, which cofactor is required the for second oxidation reaction (conversion of…
A: Fatty acid β-oxidation is the metabolic process by which fatty acids are broken down to produce…
Q: Discuss the synthesis and utilization of ketone bodies.
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: The structure given below represents what molecule? CHO I H-C-OH I CH₂OH dihydroxyacetone phosphate…
A: The molecular weight of glyceraldehyde, a pleasant, white, crystalline solid, is 90.08 g mol 1. 29…
Q: The Na,K-ATPase is a(n) [Select] [Select] and K+ from [Select] that moves Na+ from
A: When 2 species are transported in the same direction by a transporter, this type of transport is…
Q: true/false: Transamination reactions yield an a-keto acid and an amino acid.
A: The amino acids undergo reactions like transamination and deamination. As the name suggests the…
Q: 2. Complete the following for serine, tyrosine, and gylcine. a. Draw the amino acid. b. Circle the…
A: Amino acids are the building blocks of proteins. they can be classified into different groups based…
Q: What happens to the double helix when the bases pair in non complementary ways, for example a G-T…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: fatty acid designated as 20:0 is ________, while one that is designated 20:3 D5,8,11 is ________.…
A: Fatty acids are very important class of macromolecules in our body. They are the simplest type of…
Q: Energy extraction and the complete oxidation of foodstuffs requires three stages. The energy…
A: Introduction Glycolysis is a process by which glucose molecules are converted into pyruvate and…
Provide the principle of biuret test used to detect RNA. Explain in 5 sentences essay
Step by step
Solved in 2 steps
- Explain: Describe an electrochemical sensor assay method for rapid bacterial detection and identification. What are the principles and mechanisms involved? functionalization of a sensor array with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase linked DNA oligonucleotide detector probe. Explain how bacteria are being detected using an electrochemical sensorExplain in detail the symbol and abbreviations used inplant protecrion.Give three reasons why liposomes/nanoparticles are attractive drug delivery system for recombinant protein preparations?
- AGAROSE GEL ELECTROPHORESIS PRELAB ANSWER ALL QUESTIONS 1. Type of nucleotide is one of the factors that influence electrophoretic mobility. a) True b) False 2. Electrophoresis is used for DNA separation and not proteins. a) True b) False 3. DNA Polymerase is an enzyme to cut DNA into fragments for electrophoresis. a)True b)False 4. Electrophoresis apparatus consists of Gel buffer, chamber and DNA separator. a) True b) False 5. During electrophoresis, DNA fragments collect at the Cathode. a) True b) FalseElectro blotting techniques are routinely used in diagnostic microbiology for detection of a specific DNA sequence in the given bacterial culture. Explain.Explain the basic methods behind the Western blot andcomplement fixation tests.
- what are some advantages to using latex particles instead of blood cells for IM assay?The strain of λ phage t is cI857. That tells you that the cI DNA segment is disabled by a specific mutation. What is the exact genetic change in cI857? What specific property of the cI gene product does this mutation change, and how does this help titering for a plaque assay?After adding stop solution (sulphuric acid) in reaction mixture of HRP assay with TMB, yellow color becomes brighter. What is the mechanism?