Which of the following terms refer to the case when a mutation results in a partial loss of the functional activity of a gene product? (Choose all statements that are correct.) Hypomorphic mutation Null mutation
Q: Under what condition(s) will a single base change in a gene will not cause mutation in the protein
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Which of the following is a transition mutation? OG --> T G --> A G --> C
A:
Q: Which of the following gene mutations is most likely tohave the most severe impact on gene…
A: Eukaryotic genome is usually larger than prokaryotic genome. This is because of the presence of…
Q: Most mutations are harmful or neutral, although in rare instances some can be beneficial where hey…
A: TRUE
Q: mutation in a gene’s exons is more damaging than a mutation in a genes intron. Do you agree or…
A: DNA sequences consists of two parts exons and introns. Exon is that part of the DNA which directly…
Q: Two types of mutations are (1) nucleotide changes and (2) unstable genome regions that undergo…
A: Given: Two types of mutation Nucleotide changes - point mutation Unstable genome regions undergo…
Q: You suspect a protein that is being expressed has been affected by a mutation. When you examine the…
A: mutations in the DNA sequences is of many type and can effect the sequence of transcribed mRNA and…
Q: Which two of the following gene mutations would have the highest likelihood of causing a severe…
A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…
Q: A nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly…
A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…
Q: Give two DIFFERENT examples of how the following can occur: a. A point mutation in an exon that is…
A: Silent mutation - Silent mutations are mutations in DNA that do not have an observable effect on the…
Q: Point mutations arise more commonly than other types of mutations. -True or False
A: Point mutation is a mutation in which one base pair in the DNA sequence get altered.
Q: An addition or deletion mutation that results in all of the amino acids after the mutation being…
A: A mutation refers to the sudden change in DNA (deoxyribonucleic acid) that subsequently affects the…
Q: Which of the following statements best describes the effect a nonsense mutation within a gene's…
A: Mutations are the sudden change in the DNA sequence which most likely alters the amino acids encoded…
Q: A gene mutation changes a base pair from AT to GC. This change causes a gene to encode a truncated…
A: Gene is known to be the unit of heredity. It is located at the nucleus of a eukaryotic cell. The…
Q: Yes, all mutations change the resulting protein. No, the amino acid sequence has not been changed.…
A: Deoxyribonucleic acid (DNA) is the material that carries inheritable information to the succeeding…
Q: Consider the following sentence: "The dog did not eat." Which of the following variations of this…
A: Mutation is a random event. It is responsible for change the sequence of nucleotide in a gene.
Q: Which of the following terms refer to the case when a mutation results in a partial loss of the…
A: Mutation is an alteration in the DNA sequences of the genome of an organism due to environmental…
Q: Which of the following mutations near the beginning of a gene likely results in numerous amino acid…
A: Any detectable, inheritable, qualitative or quantitative change in the genetic material of an…
Q: Which of the following mutations is potentially the most harmful? O A) base-pair substitution at the…
A: Introduction: Mutation refers to the alterations that occur in the DNA sequence. They are found to…
Q: Suppose that a gene has a mutation that changes one nucleotide. Compared to the protein produced…
A: A rapid change in the sequence of DNA (deoxyribonucleic acid) due to physical or chemical factors is…
Q: One reason mutations are so problematic is that bacterial cells have no ability to repair a mutation…
A: Mutation is the process that involves a change in the normal DNA sequence. It can result from…
Q: Which of the following is not possible?a. A nonsynonymous mutation in an intronb. A nonsynonymous…
A: Nonsynonymous mutations are those mutations that can change the protein encoded by mRNA and are…
Q: If the mutation has a negligible effect on the function of a gene, it is known as aa) Silent…
A:
Q: Mutations that eliminate the function of a protein are generally associated with: missense…
A: According to guidelines we have to answer first question only. please kindly post the remaining…
Q: Which do you think would be more likely to have an effect on protein function: a silent mutation or…
A: Mutation: - Random process - non-directional - Most of the mutations are harmful. - Mutations are…
Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…
A: Mutations are the spontaneous and heritable changes in genome that occur either during DNA…
Q: Which of the following mutations is NOT a point mutation? A. Missense mutation B. Insertion…
A: Need to find which of the following is not a part of point mutation. Point mutation is a…
Q: What is mutations definition of mutations? types of mutations proper explanation and diagram
A: Answer: Introduction: Mutation- These are the random heritable changes that occurs in the DNA…
Q: Two types of mutations discussed in this chapter are 1) nucleotide changes and 2) unstable genome…
A: Mutations are sudden heritable changes in the DNA sequence of a gene and are responsible for all the…
Q: What type of mutation is depicted by the following sequences (shown as mRNA)?Wild type ....5′…
A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…
Q: Some mutations affect changes in protein structure and function that can result in disease whereas…
A: Hi! Thanks for your question. But as you have posted multiple questions, I am answering the first…
Q: Please distiguish driver mutations from passenger mutations
A: DNA gene is damaged or changed in such a way that enable to alter the gene is called mutation.
Q: Why are RNA viruses more likely to mutate than those that have genomes made of DNA? 2.What would…
A: Viruses generally have genetic material, either DNA or RNA inside a coat of proteins and…
Q: If the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the protein…
A: Mutations are the changes in the genes of the cell that causes abnormalities in the structure and…
Q: What type of mutation (transition, transversion, or frameshift)would you expect each of the…
A: Mutagens are such agent that changes the genetic material, that is, the structure of DNA…
Q: A mutation in DNA that changes a glutamine codon, CAA, to a stop codon, UAA, is called a O…
A: Mutations can occur as a consequence of DNA copying errors during cell division, exposure to…
Q: Which of the following mutations would likely have the greatest negative impact on the protein…
A: Frameshift mutations are basically known as the most injurious changes to the coding succession of a…
Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…
A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. It may be…
Q: Which of the following results in the same amino acid in its protein sequence? a. missense mutation…
A:
Q: Which of the functional groups is not reactive but serves as a recognizable tag on the DNA molecule…
A: Epigenetics is referred to as external modification to DNA that changes the sequence but cannot…
Q: As bacterial DNA replicates, a point mutation occurs in which an A nucleotide is changed to a C…
A: DNA is a helically twisted double chain polydeoxyribonucleotide macromolecule. The sequence of…
Q: Two types of mutations discussed in this chapter are 1) nucleotide changes and 2) unstable genome…
A: The mutation is a change that is due to a change in DNA due to some environmental factors or damage…
Q: A single base mutation in a gene may not 'always'result in loss of grain of function?
A: The mutation is defined as a sudden, heritable, and stable change in the genome of an organism.
Q: A mutation caused by a base deamination or a tautomerization is called a a. silent mutation b.…
A: Mutation- any changes in the gene which causes abnormality is known as mutation Deamination-…
Q: If a base was added or deleted and the reading frame shifted, this would be an example of a…
A: Mutation is the change in the sequence of DNA. This may occur due to errors in DNA copying, Ionising…
Q: Which of the following terms refer to the case when a mutation results in a complete loss of the…
A: Mutation is a sudden, discontinuous variation in genotype and phenotype of an organism due to change…
Q: A protein was mutated at amino acid position 129. Which of the following mutations will least effect…
A: The correct answer for this question is option- (d) R mutated to D
Q: How many base-pairs would have to be deleted in a mutational event to eliminate a single amino acid…
A: A mutation is an alteration or change in a deoxyribonucleic acid (DNA) sequence. Mutations can…
Q: Which type of mutation is most likely to be silent? An inversion A deletion An insertion A…
A: Mutation is the random change in the sequence of nucleotides of a gene.
Q: Two types of mutations discussed in this chapter are nucleotide changes and unstable genome regions…
A: Mutation is defined as a change that occurs in the nucleotide sequence of DNA. This can affect…
Please help me, this is from practice, double check your answers, previous tutors got it wrong
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingA wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionDescribe the mutation that occurs in the following examples (be specific, if possible): BOAT to BAT SOAP to SOUP PAY to PLAY GCTCT to GCACT TGCCC to TACCC CATGC to GATGC TATATA to TACATA
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-GlyA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-ProA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Gl
- Name three different types of loss of function mutations and in each case explain how the mutation exerts a loss of function effect on a geneA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-GlyA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
- A reversion is a mutation that returns a mutant codon back to acodon that gives a wild-type phenotype. At the DNA level, this typeof mutation can be an exact reversion or an equivalent reversion. An equivalent reversion produces a protein that is equivalent to thewild-type protein in structure and function. This outcome canoccur in two ways. In some cases, the reversion produces thewild-type amino acid (in this case, glutamic acid), but it uses adifferent codon than the wild-type gene. Alternatively, an equivalentreversion may substitute an amino acid structurally similarto the wild-type amino acid. In our example, an equivalent reversionhas changed valine to an aspartic acid. Because aspartic andglutamic acids are structurally similar—they are acidic aminoacids—this type of reversion can restore wild-type structure andfunction.Here is the question: The template strand within the codingsequence of a gene has the following sequence:3′–TACCCCTTCGACCCCGGA–5′This template produces the…A nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly describe these mutations? They are permanent and cannot revert or reverse mutate back into a wild-type sequence. They cause a non-functional amino acid to replace a functional amino acid. O They result in the insertion or deletion of a small number of nucleotides to the DNA. They change the nucleotide sequence of a gene but do not change the sequence of the resulting protein. None of the provided answers are correct. They convert a codon for a particular amino acid within a gene into a stop codon. They insert an additional amino acid into the final protein product.The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…