90. If the mRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3' , then what is the corresponding tRNA anticodon sequence?                                                                             A.5' - UAC - AAA - UUU - UCA

Q: II. Do what is asked A. 1. a. Use the codon given below to complete the following table. Assume that…

A:

Q: A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine…

A: In this question, we are given with a portion of mRNA which has a sequence 5' GACAUGAACAGC 3'. mRNA…

Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…

A: Red blood corpuscles (RBC) are the cells that carry oxygen thorough out the body. They are small…

Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: 120. What is the nature of the molecule coded by each codon(triplet code) of mRNA? A.Peptide bond…

A: Triplet code is a three amino acid each codon (within the code), consists of three, nonoverlapping…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: 1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U…

A: Only proline amino acid form as second codon is stop codon here

Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…

A:

Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…

A: The translation is a process by which proteins are synthesized. It is the last step of the central…

Q: Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence…

A: Introduction :- The proteins are synthesized with the help of protein synthesizing machinery which…

Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…

A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…

Q: All of the following occur when the amino acids of two tRNA molecules are joined, except. a. The…

A: DNA replication, transcription, and translation are the molecular processes that are responsible for…

Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…

A: The process of synthesizing RNA from the genetic information encoded by DNA is called Transcription…

Q: 5. A mutant strain of Salmonella bacteria carries a mutation of the rho protein t hat has full…

A: Rho factor is involved in termination of transcription in prokaryotes. It binds to termination site.

Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…

A: DNA to mRNA is transcription and mRNA to protein is translation.

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon  It is the three consecutive sequence of a mRNA that code for amino acid.

Q: 5' Capping and 3' polyadenylation of eukaryotic mRNA : a. Destabilize MRNA b. are required for…

A: Introduction:: The correct choice is option (b).

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: 6. How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce? (LS1-1) * Second MRNA…

A: The translation is the process by which the information on the mRNA is transferred into appropriate…

Q: The sequence of bases in a sample of MRNA was found to be: GGU,AAU,CCU,UU0,GUU,ACU,CAU,UGU a Deduce…

A: mRNA is messenger RNA which is produced as a result of transcription from DNA. RNA polymerase…

Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by…

A: 1) Option D is correct answer for this question because It is this mRNA which decide the sequence of…

Q: Which of the following statements below is incorrect? *   A. the genetic code is overlapping   B.…

A: As per guidelines, you have asked multiple questions we will solve the first question for you. If…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic…

A: Single base pair mutation in mRNA transcript in Eukaryotes is less serious because mRNA of Eukarotes…

Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…

A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…

Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…

A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…

Q: 46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA…

A: Ribosomes are the protein factories of the cell. These are responsible for protein synthesis by…

Q: All of the following are functions of introns EXCEPT A. Provide buffering capacity against mutations…

A: Introns are non coding sections of RNA transcripts that are removed by splicing before the…

Q: Convert the DNA template to mRNA.  Then, convert the mRNA  to tRNA. Based from the resulting…

A: Central dogma- RNA is produced from DNA with the help of transcription and then RNA is converted to…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming…

A: Hello! According to guidelines we have to answer the first 3 sub-parts only. so please kingly post…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding…

A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for…

Q: Which of the following statements about mRNA is correct? a. Eukaryotic mRNA is generally…

A: Introduction:- Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: A tRNA to which the correct amino acid has been attached is called

A: tRNAs bind to codons within the ribosome and deliver amino acids for the protein chain to be…

Q: There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs.  This is best explained by…

A: Answer: Introduction: The mRNA codons are read while translation, starting with a start codon and…

Q: 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA.

A: 7. In all living organisms, the material that  contains  the information which is transmitted from…

Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTY by Smith 4th Edition

A: mRNA or messenger RNA is a polymer of ribonucleotides that has a sequence corresponding to the…

Q: 30  A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: The process of translating an mRNA strand into an amino acid sequence at the time of protein…

Q: Given the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write…

A: Nucleic acids are the essential macro molecules that carry and transmit genetic information in the…

Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…

A:

Q: (D) An experiment by Gobind Har Khorana and his colleagues used a synthetic RNA sequences consisting…

A: mRNA: Messenger RNA It is a type of RNA that plays a very important role in protein synthesis…

Q: What happens immediately after the initiation complex forms during translation? (a) peptide bond…

A: Translation is biological process which involves protein synthesis with the help of mRNA i.e.…

Q: 40.The mRNA codon for methionine is the start codon in eukarvotes. What is the corresponding three…

A: The start codon is the sequence of three nucleotides present on mRNA that is responsible for the…

Q: 1. a)What are the two types of ncRNA used in translation?  b.) How is translation terminated when…

A: Translation is the phenomenon in which the ribosomes present in the cytoplasm carry out the process…

Q: 5’ UGG CAA UCC UAC GAU 3’   Write out the sequence of the anticodon in the tRNA that would bind to…

A: Note: As per the guidelines only one question has to be answered. Please ask the other question…

Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…

A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.